Efficacy of alirocumab according to background statin type and dose: pooled analysis of 8 ODYSSEY Phase 3 clinical trials

Abstract

Low-density lipoprotein cholesterol (LDL-C) reductions with the PCSK9 monoclonal antibody alirocumab may be affected by background statin dose due to increased PCSK9 levels with higher statin doses. Data from 8 Phase 3 trials conducted with background statin (n = 4629) were pooled by alirocumab dose (75 or 150 mg every 2 weeks) and control (placebo/ezetimibe), and analyzed by background statin type/dose. Overall, 58.4% received high-dose statins (atorvastatin 40–80 mg, rosuvastatin 20–40 mg, simvastatin 80 mg), 28.6% moderate-dose statins (atorvastatin 20–<40 mg, rosuvastatin 10–<20 mg, simvastatin 40–<80 mg), and 12.9% low-dose statins (atorvastatin <20 mg, rosuvastatin <10 mg, simvastatin <40 mg). Mean baseline PCSK9 levels were higher with high versus moderate and low statin doses (318.5 vs 280.6 ng/mL). Baseline LDL-C levels were similar across pools, regardless of statin intensity. No associations were observed between statin type/dose and LDL-C % change from baseline or % of patients achieving LDL-C goals at Week 24 for alirocumab versus control (interaction P-values non-significant). Incidence of adverse events was similar for alirocumab versus control, except for a higher rate of injection-site reactions with alirocumab. In summary, alirocumab provided consistent LDL-C reductions and was generally well tolerated independent of background statin type/dose.

Sauchinone controls hepatic cholesterol homeostasis by the negative regulation of PCSK9 transcriptional network

“…The option -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT were used for the common adapter sequence of the Illumina TruSeq adapters and the option −q 0, −m 20, −O 3 was used for trimming low quality 5′ and 3′ ends of the raw reads. The cleaned high quality reads after trimming the low quality bases and sequencing adapters were mapped to the mouse reference genome mm10 of the UCSC genome ( https://genome.ucsc.edu ) by STAR software 50 . Since the sequencing libraries were prepared strand-specifically by using Illumina’s strand-specific library preparation kit, the strand-specific library option,–library-type fr-firststrand was applied in the mapping process.…”

Efficacy and safety of alirocumab in Korean patients with hypercholesterolemia and high cardiovascular risk: subanalysis of the ODYSSEY-KT study

“…In studies on Japanese patients (with or without heFH), alirocumab treatment reduced LDL-C levels by at least 40% [20,21]. Similar to the results observed in this Korean population, a pooled analysis of eight ODYSSEY phase 3 trials (n = 4,629) indicated that alirocumab provided consistent reductions in LDL-C regardless of the statin dose and type [25]. In the ODYSSEY LONG TERM trial (n = 2,341), TEAEs were observed in 81% of alirocumab-treated patients [19], which is more than that observed in the Korean cohort (45%).…”

Alirocumab in high-risk patients: Observations from the open-label expanded use program

“…The safety and efficacy observations with alirocumab in this open-label program, which included very high-risk and difficult to treat patients with uncontrolled LDL-C who had exhausted other lipidlowering treatment options, were consistent with those in the ODYSSEY trials 4,5,7,8,16,17 as well as pooled subanalyses of patients with HeFH 6 and by statin type and dose. 18 Although this expanded use program required patients to be on maximally tolerated statin therapy as in the majority of ODYSSEY trials, this program was distinct from most ODYSSEY trials (which permitted only simvastatin, atorvastatin, or rosuvastatin) as patients were permitted to use all available statins. Moreover, patients who were documented as being unable to tolerate any dose of statin were included in the program.…”