Effects of Schizochytrium and micro-minerals on immune, antioxidant, inflammatory and lipid-metabolism status of Micropterus salmoides fed high- and low-fishmeal diets

Abstract

A 12-week factorial experiment was conducted to investigate the interactive effects of dietary algal meal (Schizochytrium sp., AM) and micro-minerals (MM, either organic [OM] or inorganic [IM]) on the immune and antioxidant status, and the expression of hepatic genes involved in the regulation of antioxidants, inflammatory cytokines, lipid metabolism, and organ growth of largemouth bass (LMB; Micropterus salmoides) fed high-and low-fishmeal (FM) diets. For this purpose, two sets of six isonitrogenous (42% crude protein) and iso-lipidic (12% lipid) diets, such as high (35%) and low (10%) FM diets were formulated. Within each FM level, AM was used to replace 50% or 100% of fish oil (FO), or without AM (FO control) and supplemented with either OM or IM (Fe, Zn, Mn, Cu, and Se). Diets were fed to juvenile LMB (initial weight, 25.87 ± 0.08 g) to near satiation twice daily. The results indicated that FO replacement by dietary AM did not change the levels of most biochemical (ALB, AMY, TP and GLOB), antioxidants (SOD, GPx and GSH), and immune (IgM and lysozyme) parameters in LMB, except ALP and CAT. MM affected only hepatic GSH, with lower values in fish fed the OM diets. FM influenced the levels of ALP, AMY, GLOB, IgM, and MDA (P < 0.05). A three-way interactive effect (P = 0.016) was found on IgM only, with lower levels in fish fed diet 12 (low-FM, AM100, OM). Subsequently, the relative expressions of hepatic antioxidants (Cu/Zn-SOD and GPx-4), inflammatory cytokines (TNF-α and TGF-β1), lipid metabolism (FASN and CYP7A1), and organ growth (IGF-I) related genes were affected by the dietary treatments, with interactions being present in Cu/Zn-SOD, TNF-α, TGF-β1, FASN and IGF-I. Overall, dietary AM could be used as an alternative to FO in low-FM diets without compromising the health of LMB, especially when it is supplemented with MM. Algae have been recognized as an alternative source of fatty acids (especially eicosapentaenoic acid [EPA], docosahexaenoic acid [DHA], and arachidonic acid [ARA]) for use in aquafeeds 1. Micro-algae, such as Schizochytrium sp., and other thraustochytrids are recognized as prominent, sustainable, and alternative sources of oils rich in long-chain n-3 polyunsaturated fatty acid (n-3 LC-PUFA) since fisheries providing food-grade fishmeal (FM) and fish oil (FO) have already reached their limit of sustainability 2-4. Individually or in combination, micro-minerals (MM) including iron (Fe), zinc (Zn), manganese (Mn), copper (Cu) and selenium (Se) are involved in diverse physiological functions such as facilitating cofactors of several enzymes, antioxidant defense, reduction of

The effects of fish meal substitution by clam meal on the growth and health of Florida pompano (Trachinotus carolinus)

“…The liver of fish is a tissue with large unstructured fatty acids that present a risk to fish due to oxidative stress 56 . To overcome this risk, fish are equipped with an antioxidant defense system to (i) maintain endogenous ROS at a low level, and (ii) attenuate the oxidative damage resulting from high ROS reactivity 6 , 7 , 11 , 12 . An increase in free radicals causes overproduction of MDA, which is one of the final products of lipid peroxidation in the cells 7 .…”

“…The content of hepatic peroxide [MDA], activity of hepatic antioxidant enzymes [superoxide dismutase (SOD) and glutathione peroxidase (GPx)], and level of plasma biochemistry [total protein (TP), alkaline phosphatase (ALP), alanine aminotransferase (ALT), and immunoglobulin M (IgM)] were analyzed spectrophotometrically (microplate reader BioTek™, Synergy™ H1, USA) using commercial kits following manufacturer’s protocols (BioVision, Milpitas, CA, USA) according to Habte-Tsion et al 5 – 7 .…”

“…The physio-biochemical, immune and antioxidant parameters have been reported as key indicators of fish health in fish nutrition studies 3 – 8 . Blood parameters are also important indicators of fish health status in response to dietary treatments 3 , 5 – 7 , 9 , 10 . Liver is one of the target organs in fish nutrition studies with large quantities of unsaturated fatty acids.…”

Responses of largemouth bass ( Micropterus salmoides , Lacépède, 1802) to fishmeal‐, and fish oil‐free diets

“…It should nevertheless be noted that dietary alternative proteins and oils have been associated with significant changes in various physiological control processes. For example, increased oxygen consumption, elevated pepsin levels, disturbance in various hepatic enzymes, changes in hepatic gene expression profiles, negative impacts on LMB immunity and, inter alia , histopathological effects upon the gut and changes therein to the microbiome have all been detected (e.g., Habte‐Tsion et al, 2020; He et al, 2020; Shi et al, 2019; Subhadra et al, 2006a; Zhang, Li, et al, 2019, Zhang, Tan, et al, 2019; Zhou et al, 2018; Zhu et al, 2019). Whether these and other adjustments are consequential to animal welfare and production remains unresolved, but each certainly deserves further examination.…”

Assessment of total dietary phosphorus requirement of juvenile largemouth bass, Micropterus salmoides , using soybean meal‐based diets: Effects on production performance, tissue mineralization, physiological parameters in plasma and intestine and expression of head‐kidney genes

“…Then, oligo dT primers (50 µM) were added to reverse transcribe the RNA at 37°C for 15 min and subsequently inactivation at 85°C for 5 s. Target genes included growth hormone (GH), insulin‐like growth factor 1 (IGF‐1), fatty acid synthase (FASN), copper (Cu)/Zn‐superoxide dismutase (SOD), tumour necrosis factor alpha (TNF‐α) and transforming growth factor (TGF‐β1). All gene‐specific primers were designed according to the partial cDNA sequences of the target genes for M. salmoides (GH: forward, 5’‐ AGGAGCAGCGTCAACTCAAC‐3’; reverse, 5’‐TGTGTCTCGTGCTTGTCGAT ‐3’; accession # DQ666528) or by using published sequences (Habte‐Tsion et al., 2020), and were synthesized by invitrogenTM (Life technologies, USA). Expression of target mRNA levels was determined through real‐time PCR using PrimeScript™ Reagent Kit (Takara), according to standard protocols.…”