Effects of resveratrol on in vitro maturation of porcine oocytes and subsequent early embryonic development following somatic cell nuclear transfer

Abstract

As a natural plant‐derived antitoxin, resveratrol possesses several pharmacological activities. This study aimed to evaluate the effects of resveratrol addition on nuclear maturation, oocyte quality during in vitro maturation (IVM) of porcine oocytes and subsequent early embryonic development following somatic cell nuclear transfer (SCNT). Our experiments showed that the treatment of porcine oocytes with 5 µM resveratrol during IVM resulted in the highest rate of the first polar body extrusion. Treatment of oocytes with resveratrol had no influence on cytoskeletal dynamics, whereas it significantly increased glucose uptake ability compared to the control oocytes. Oocytes matured with 5 μM resveratrol displayed significantly lower intracellular reactive oxygen species (ROS) levels and higher relative mRNA expression levels of the genes encoding such antioxidant enzymes as catalase (CAT) and superoxide dismutase 1 (SOD1). In addition, resveratrol also prevented onset and progression of programmed cell death in porcine oocytes, which was confirmed by significant upregulation of the anti‐apoptotic B‐cell lymphoma 2 (BCL‐2) gene and significant downregulation of the pro‐apoptotic BCL2‐associated X (BAX) gene. Furthermore, the blastocyst rates and the blastocyst cell numbers in cloned embryos derived from the oocytes that had matured in the presence of 5 μM resveratrol were significantly increased. In conclusion, supplementation of IVM medium with 5 μM resveratrol improves the quality of porcine oocytes by protecting them from oxidative damage and apoptosis, which leads to the production of meiotically matured oocytes exhibiting enhanced developmental potential following SCNT.

CRISPR/Cas9‐mediated MSTN disruption accelerates the growth of Chinese Bama pigs

“…Design and construction of CRISPR/Cas9 plasmid were performed according to our previous studies (Wang, Zhu, et al, 2019; Zhu, Zhong, Ge, Lu, & Lu, 2018a). Two sgRNAs, namely sgRNA1 as CTGTTTATGCTGATTGTTGCTGG and sgRNA2 as GCTGATTGTTGCTGGTCCCGTGG (the protospacer adjacent motif (PAM) sequence was labelled with underline), used for targeting exon 1 of MSTN (NCBI gene ID: 399,534) were designed by the CRISPR Design Tool (http://crispor.tefor.net).…”

“…Genotyping of CRISPR/Cas9‐mediated gene‐editing in pig cells was conducted according to our previous studies (Wang, Zhu, et al, 2019; Zhu et al., 2018a). Genomic DNA was extracted from cell colonies and tail tissues of newborn cloned piglets by using a TIANamp Genomic DNA Kit (Tiangen, Beijing, China).…”

“…Detection of CRISPR/Cas9 plasmid integration in gene‐editing positive cell colonies was conducted by PCR reaction according to our previous studies (Wang, Zhu, et al, 2019; Zhu et al., 2018a). One pair of specific primers (PF: 5′‐CGGAGACTACAAGGATCATG‐3′ and PR: 5′‐TATCCTCTTCCACCAGGAAG‐3′) has been used for amplification of CRISPR/Cas9 plasmid, resulting in 428 bp amplicons.…”

CRISPR/Cas9-Mediated Biallelic Knockout of IRX3 Reduces the Production and Survival of Somatic Cell-Cloned Bama Minipigs

“…Procedures used for the isolation, cultivation, and transfection of newborn Bama minipig kidney fibroblasts were based on our previous studies [1,41,[67][68][69][70]. After establishing deep anesthesia, the piglet was euthanized and its bilateral kidneys were collected and minced in Dulbecco's phosphate buffered saline (DPBS; Gibco, Grand Island, NY, USA).…”

“…Procedures used for donor cell preparation, in vitro maturation of porcine oocytes, somatic cell nuclear transfer (SCNT), and embryo transfer were according to our previous studies [1,41,68,69]. Briefly, gene-edited cell colonies that did not have exogenous genes integrated and did not harbor any off-targets were used for producing mutant minipigs.…”