Effects of intrinsic tannins on proteolysis dynamics, protease activity, and metabolome during sainfoin ensiling

Abstract

Condensed tannins (CT) from sainfoin have a high capacity to inhibit proteolysis. A previous study reported that CT from sainfoin can inhibit lactic acid bacteria activity and decrease ammonium-nitrogen (N) content during sainfoin ensiling; however, no study has focused on the metabolome of ensiled sainfoin. The objective of the present study was to investigate the effects of CT [following supplementation of deactivated CT with polyethylene glycol (PEG)] on protease activity, keystone bacteria, and metabolome during sainfoin ensiling. According to the results, PEG amendment increased non-protein N, amino acid, and soluble protein contents significantly (in the 49.08–59.41, 116.01–64.22, and 23.5–41.94% ranges, respectively, p < 0.05) during ensiling, whereas neutral detergent-insoluble protein and acid detergent-insoluble protein were decreased significantly (in the 55.98–64.71 and 36.58–57.55% ranges, respectively, p < 0.05). PEG supplementation increased aminopeptidase and acid protease activity after 3 days of ensiling (p < 0.05) and increased carboxypeptidase activity during the entire ensiling process (p < 0.05). The keystone bacteria changed following PEG addition (Stenotrophomonas, Pantoea, and Cellulosimicrobium in the control vs. Microbacterium, Enterococcus, and Brevundimonas in the PEG-treated group). In total, 510 metabolites were identified after 60 days of sainfoin ensiling, with 33 metabolites annotated in the Kyoto Encyclopedia of Genes and Genomes database. Among the metabolites, phospholipids were the most abundant (72.7% of 33 metabolites). In addition, 10 upregulated and 23 downregulated metabolites were identified in the PEG-treated group when compared with the control group, after 60 days of ensiling (p < 0.05). Pediococcus (correlated with 20 metabolites, R2 > 0.88, p < 0.05) and Lactobacillus (correlated with 16 metabolites, R2 > 0.88, p < 0.05) were the bacteria most correlated with metabolites. The results suggested antagonistic effects between Lactobacillus and Pediococcus during ensiling. The decreased proteolysis during sainfoin ensiling was mainly attributed to the inhibition of protease activity by CT, particularly carboxypeptidase activity. In addition, proteolysis decreased partly due to CT inhibiting Pediococcus activity during ensiling, with Pediococcus being significantly and positively correlated with dopamine after 60 days of ensiling (R2 = 0.8857, p < 0.05).

Chemical characteristics, antioxidant capacity, bacterial community, and metabolite composition of mulberry silage ensiling with lactic acid bacteria

“…Further study is needed to determine whether these bacteria secrete proteases during ensiling. Additionally, the inhibition of Pediococcus activity partly resulted in lower protein degradation during ensiling, which is attributed to Pediococcus having the capacity to facilitate Enterobacter activity for amino acid degradation (Huang et al, 2022 ). Inoculation with S. bovis or L. plantarum alone decreased AN content compared to the control group ( P < 0.05).…”

Potential factors causing failure of whole plant nettle (Urtica cannabina) silages

“…Primers (338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGG TWTCTAAT) targeting the V3–V4 regions of 16S rDNA were used to conduct PCR amplification. The amplicons were extracted, purified, and the raw sequences analyzed, according to ( Huang et al, 2022a ). The sequences were uploaded on the NCBI Sequence Read Archive (SRA) (Accession No.…”

“…The metabolites were extracted and analyzed according to ( Huang et al, 2022a ). Briefly, 50-g samples were taken from each fermentation treatment, with five replicates for each treatment.…”

“…Several studies have observed a strong capacity of nettle to inhibit gram-positive and gram-negative bacteria that belong to Enterococcus , Enterobacter , Bacillus , Lactobacillus , etc., at the genus level, in dose dependent manners ( Kregiel et al, 2018 ). Among the bacteria above, the Enterococcu s and Lactobacillus are the most important lactic acid bacteria (LAB) observed during ensiling ( Huang et al, 2022a ). Therefore, the antibacterial activity of nettle could theoretically inhibit some bacterial activity during ensiling.…”

Effects of Cocoa Pod Husk Extract (Theobroma Cacao L.) on Alveolar Bone in Experimental Periodontitis Rats

“…The antibacterial activity of cocoa pod extract gel is found in the content of tannins and terpenoids. Tannins have the ability to inhibit the work of protease enzymes which cause bacterial metabolic processes to be disrupted so that they can cause death in bacteria [26]. Terpenoids compounds are also used as antibacterial agents by damaging the membranes of lipophilic compounds by forming strong polymer bonds and damaging porins, reducing the permeability of the bacterial cell wall so that it can cause bacterial cells to lack nutrition and inhibit bacterial growth or die [27].…”