Effects of hypoxia on pluripotency in murine iPS cells

Sugimoto, Kouji; Yoshizawa, Yuu; Yamada, Sōichiro; Igawa, Kazunari; Hayashi, Yoshihiko; Ishizaki, Hidetaka

doi:10.1002/jemt.22269

Cited by 8 publications

(9 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To evaluate the mRNA expression of Nanog, Sox2, and Oct4 as pluripotency marker genes, the iPS cells were harvested using the Trizol reagent (Life Technology, Carlsbad, CA, USA). RT‐PCR was carried out using our previous methods (Sugimoto et al, ). The sequences of primers used were as follows: NANOG F, 5′‐TGCAAGAACTCTCCAACATCC‐3′, and R,5′‐CCAGTTGTTTTTCTGCCACCTC‐3′; SOX2 F, 5′‐CAAGATGCACAACTCGGAGA‐3′ and R, 5′‐GCTTAGCCTCGTCGATGAAC‐3′; OCT4, F 5′‐AGTGCCCGAAACCCACACT‐3′ and R, 5′‐ACAGAACCACACTCGGACCA‐3′.…”

Section: Methodsmentioning

confidence: 99%

“…Although LIF is not added to the culture medium, bFGF and feeder cells are generally necessary to maintain of the pluripotent state of human iPS cells. Our previous study in murine iPS cells showed that the stemness was significantly maintained under hypoxic conditions compared to normoxia and HIF‐2α among HIFs is the most influential factor for maintaining pluripotency (Sugimoto et al, ). Nevertheless, little is known about how hypoxia can maintain the pluripotent state in human iPS cells through HIFs.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Effects of hypoxia inducible factors on pluripotency in human iPS cells

Sugimoto

Mizutani

Nakazono

et al. 2018

Microscopy Res & Technique

Self Cite

View full text Add to dashboard Cite

A hypoxic condition is known to contribute to pluripotency. In the present article, the effects of transcription factors were first assessed regarding the proliferation and differentiation of human induced pluripotent stem (iPS) cells under hypoxic conditions using cell morphology and real-time polymerase chain reaction (RT-PCR). Morphology evaluations and RT-PCR revealed that the colony formation was promoted and the expression of pluripotent markers was increased under hypoxic conditions. In addition, the function of hypoxia inducible factors (HIFs) in human iPS cells under hypoxic conditions was evaluated in relation to the morphology and the expression of pluripotency markers by siRNA and RT-PCR. The HIF-2α silencing group showed a reduction in the colony size of human iPS cells and a statistically significant reduction in the expression of undifferentiation markers compared to the control group. Furthermore, the expression of HIF-2α was decreased when signal transducer and activator of transcription 3 (STAT3) was suppressed by its inhibitor, Stattic or S31 201. The inhibition using Stattic did not produce colony formation. The expression of pluripotent markers was also decreased using Stattic or S31 201. This study indicates that the HIF-2α expression in human iPS cells was activated under hypoxic conditions, similarly to that in murine iPS cells, and that HIF-2α among HIFs is the most effective compound for maintaining the pluripotency of human iPS cells. Furthermore, the STAT3 signal pathway regulates the expression of HIF-2α.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Effects of hypoxia inducible factors on pluripotency in human iPS cells

Sugimoto

Mizutani

Nakazono

et al. 2018

Microscopy Res & Technique

Self Cite

View full text Add to dashboard Cite

show abstract

“…In addition, this metabolic change was shown in embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) and MSCs under hypoxic condition, and it enhanced cell proliferation, stability of chromosomes, and stemness (Forristal et al, 2010;Estrada et al, 2012;Sugimoto et al, 2013).…”

Section: Enhanced Angiogenesis By Hypoxia Huc-mscsmentioning

confidence: 98%

“…In general, hypoxia is an enhancing factor for the survival and proliferation of tumor cells by shifting the metabolism from oxidative phosphorylation to glycolysis (Chesney et al, 2014). In addition, this metabolic change was shown in embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) and MSCs under hypoxic condition, and it enhanced cell proliferation, stability of chromosomes, and stemness (Forristal et al, 2010;Estrada et al, 2012;Sugimoto et al, 2013).…”

Section: Enhanced Angiogenesis By Hypoxia Huc-mscsmentioning

confidence: 99%

Enhancement of angiogenic effects by hypoxia‐preconditioned human umbilical cord‐derived mesenchymal stem cells in a mouse model of hindlimb ischemia

Han

Kim

et al. 2015

Cell Biology International

View full text Add to dashboard Cite

It has been studied that mesenchymal stem cells (MSCs) have the capability to promote angiogenesis. Furthermore, there is strong evidence that hypoxic conditions can enhance angiogenesis and immune modulation mediated by MSCs, a notion that has been applied in many fields of clinical application. In the present study, we compared the efficacy of hypoxia preconditioned human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) and normoxia conditioned hUC-MSCs for the treatment of ischemic injury in hindlimbs of an immunodeficient mouse model. Expression of negative markers for MSC such as CD31, CD34, and CD45 or positive markers such as CD44, CD73, CD90, and CD105 was not significantly changed in hypoxia preconditioned hUC-MSCs compared with hUC-MSCs cultured in normoxic condition. Expression of angiogenesis-related genes such as COX-2, VEGF, Tie-2, and TGF-β1 was increased compared with hUC-MSCs cultured in normoxic conditions. In the in vivo model, CD31 expression as a marker of angiogenesis was significantly increased in the ischemic limbs at 1 month after injection with hypoxic hUC-MSCs. Angiogenesis-related genes such as Ang-1, COX-1, PIGF, and MCP-1 were significantly upregulated in the muscle of ischemic hindlimbs treated with hypoxic hUC-MSCs than normoxic hUC-MSCs. Expression of proinflammatory genes such as IL-1, and IL-20 was reduced, whereas TGF-β1, which has an anti-inflammatory effect, was strongly increased. In conclusion, hypoxic culture conditions could induce expression of angiogenesis related genes in hUC-MSCs, and hypoxia preconditioned hUC-MSCs showed enhancing effects by inducing angiogenesis and low inflammatory immune response compared with normoxic hUC-MSCs in the ischemia injured hindlimb of immunodeficient mice.

show abstract

“…Sugimoto and colleagues found that mouse iPSCs cultured under 5% oxygen demonstrated rapid cell growth compared to that at 20% oxygen (119). How hypoxia regulates pluripotency in iPSCs is not fully understood, partly due to different approaches and cell sources in generating iPSCs.…”

Section: Stem Cells In Tissue Engineeringmentioning

confidence: 99%

Stem Cells in Skeletal Tissue Engineering: Technologies and Models

Langhans¹,

Yu²,

Tuan

2016

CSCR

View full text Add to dashboard Cite

This review surveys the use of pluripotent and multipotent stem cells in skeletal tissue engineering. Specific emphasis is focused on evaluating the function and activities of these cells in the context of development in vivo, and how technologies and methods of stem cell-based tissue engineering for stem cells must draw inspiration from developmental biology. Information on the embryonic origin and in vivo differentiation of skeletal tissues is first reviewed, to shed light on the persistence and activities of adult stem cells that remain in skeletal tissues after embryogenesis. Next, the development and differentiation of pluripotent stem cells is discussed, and some of their advantages and disadvantages in the context of tissue engineering is presented. The final section highlights current use of multipotent adult mesenchymal stem cells, reviewing their origin, differentiation capacity, and potential applications to tissue engineering.

show abstract

Effects of hypoxia on pluripotency in murine iPS cells

Cited by 8 publications

References 45 publications

Effects of hypoxia inducible factors on pluripotency in human iPS cells

Effects of hypoxia inducible factors on pluripotency in human iPS cells

Enhancement of angiogenic effects by hypoxia‐preconditioned human umbilical cord‐derived mesenchymal stem cells in a mouse model of hindlimb ischemia

Stem Cells in Skeletal Tissue Engineering: Technologies and Models

Contact Info

Product

Resources

About