Effects and characterization of paracrine factors produced by human prostate stromal cells in bioassays using rat Sertoli cells, LNCaP tumor cells, and cultured prostate epithelial cells

Abstract

PFCM provokes differentiating effects in a Sertoli cell bioassay, but unlike with rat stromal cells, the factor(s) involved differ from PModS. In the two homologous systems studied, differentiating effects could not be demonstrated and discordant effects were noted on proliferation. Various bioassay systems will be required to identify the spectrum of mediators present in PFCM.

High‐throughput live‐cell imaging reveals differential inhibition of tumor cell proliferation by human fibroblasts

“…The induction of cell enlargement and of increased EGFP production, but not the inhibition of cell proliferation, was transferable with conditioned media of the mixed cultures. This is in line with previous findings, showing that prostate fibroblast conditioned media led to an overall increase of RNA content of LnCap cells 10. The pronounced increase of EGFP fluorescence in growth inhibited tumor cells also indicates that total EGFP intensity of labeled tumor/unlabeled fibroblast cultures is not an appropriate parameter to estimate the cell number, as recently done in a large study that analyzed the effect of fibroblasts on the gene expression of various tumor cells 36.…”

“…Inhibition of LnCap prostate carcinoma cells by co‐cultured fibroblasts or by fibroblast‐conditioned media was previously attributed to soluble factors 10, 12, 35. Using EGFP‐labeled LnCap cells, co‐cultured with human fibroblasts from different donors, we could show that all fibroblasts inhibited the proliferation of LnCap cells.…”

“…Similar inhibitory effects were described for human normal/neoplastic cell combinations 6–9. Mixed tumor cell/fibroblast cultures played important roles in the identification of the paracrine inhibitory activities of transforming growth factor (TGF)‐beta,10 tumor necrosis factor (TNF)‐alpha11 and interleukin (IL)‐6 11, 12. It was also suggested that fibroblasts from cancer patients may show different migratory activity in vitro compared to fibroblasts from tumor free controls 13, 14.…”

Establishment and characterization of a primary androgen‐responsive African‐American prostate cancer cell line, E006AA

“…The karyotypic finding is reported as 75XX, der(4)t(4;5)(q35;q31), del(5)(q15), þdel(5)(q15), þ6, þ6,i(8)(q10), þi(8)(q10), add(9)(q34), der(9)i(9)(q10)add(9)(q34)x2, þ10,add(11) (q13), der(13;14)(q10;q10), À14, þ17, À18, add(18) (p11.3), del(20)(q12), þdel(20)(q12), þ21, þmar. In summary, the cells are hypertriploid with additional numerical gains in chromosomes 5,6,8,10,17,20,21 and a marker chromosome of unknown origin. Structural abnormalities are also present in chromosomes 4,5,8,9,11,12,13,14,18, and 20 and the Y chromosome is missing in this routine karyotype.…”

“…The 50 ml PCR reactions contained 36.6 ml of MicroPure water, 5 ml of 10Â PCR buffer, 3.0 ml of 25 mM MgCl 2 , 0.4 ml of 100 mM dNTP mix, 1.0 ml of both sense and antisense primers, and 0.5 ml of Taq polymerase (5 U/ml). The primers for AR (GEN-EMBL accession number M27423) and PSA [8] were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). The sequence of the primers was as follows: AR sense, GCCTGTTGAACTCTTCTGAGC; AR antisense, GCTGTGAAGGTTGCTGTTCCTC; PSA sense, TACCCACTGCATCAGGAACA; PSA antisense, CCTTGAAGCACACCATTACA; b2-microglobulin (b2-mGB) sense, ATGCCTGCCGTGTGAACCATGT; b2-mGB antisense, AGAGCTACCTGTGGAGCAAC-CT. PCR was carried out using T-gradient model (Biometra, Gottingen, Germany) under the following conditions: 30 cycles of 958C for 1 min, 588C for 1.5 min, 728C for 1.5 min with a final 10 min extension cycle at 728C.…”