E280A PS‐1 mutation causes Alzheimer's disease but age of onset is not modified by ApoE alleles

Lendon, Corinne; Martínez, Alonso; Behrens, María Isabel; Kosik, Kenneth S.; Madrigal, Lucía; Norton, Joanne; Neuman, Rosalind J.; Myers, Amanda; Busfield, Frances; Wragg, Michelle; Arcos, Mauricio; Viana, Juan Carlos Arango; Ossa, Jorge; Ruíz, A Navarro; Goate, Alison; Lopera, Francisco

doi:10.1002/(sici)1098-1004(1997)10:3<186::aid-humu2>3.3.co;2-k

Cited by 25 publications

(32 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A study in the large genealogies from Antioquia (Colombia), which probably correspond to a founder effect, confirmed the absence of modulation of the age of onset by APOE genotype in presenilin 1 (PSEN -1) mutation bearers 27 . Also, in 2 Cuban families, there was some relationship between the APOE genotype and age at onset 28 .…”

Section: Discussionmentioning

confidence: 99%

APOE epsilon4 and Alzheimer's disease: positive association in a Colombian clinical series and review of the Latin-American studies

Jacquier

Arango

Villareal

et al. 2001

Arq. Neuro-Psiquiatr.

View full text Add to dashboard Cite

-Objective: As the strength of the association between the APOE ε4 allele and Alzheimers disease (AD) varies across ethnic groups, we studied if there was such an association in Colombian patients. Method: We performed apolipoprotein E (APOE) genotyping in a clinical sample of 83 unrelated AD patients, predominantly late-onset (>65 yrs) including familial ( n =30) and sporadic AD cases (n= 53) diagnosed according to NINCDS-ADRDA criteria and assessed by a multi-disciplinary team. Control subjects (n = 44) had no significant cognitive impairment by medical interview and neuro-psychological testing. Results: We found a high association (OR= 5.1 95%CI 1.9 -13.6) between APOE ε4 and AD, in this series with predominantly late-onset cases with familial aggregation in 24 cases (28.9%). A significant negative association was found between ε2 and AD (OR= 0.2 95% CI 0.05-0.75). Conclusion: Further population-based surveys in Colombia are warranted to precise a possible dose effect of APOE ε4.KEY WORDS: Alzheimers disease, APOE, dementia, risk factors, ethnic groups, Colombia.Asociación positiva entre apoe ε ε ε ε ε4 y demencia de Alzheimer en una serie clinica en Bogotá (Colombia) y revision de los estudios latinoamericanos RESUMEN -Objetivo: Como la fortaleza de la asociación entre el alelo ε4 del gen APOE y la enfermedad de Alzheimer (EA) difiere entre grupos étnicos, quisimos evaluar si esta asociación existe en pacientes colombianos. Métodos: Realizamos una genotipificación para el gen de la apolipoproteina E (APOE) en una muestra clínica de 83 pacientes con EA no relacionados, de inicio predominantemente tardío (> 65 años), incluyendo casos familiares (n=30) y esporádicos (n=53) diagnosticados según los criterios del NINCDS-ADRDA y evaluados por un equipo multi-disciplinario. Los sujetos control (n= 44) no presentaban deterioro cognoscitivo de acuerdo con la entrevista médica y la evaluación neuropsicológica. Resultados: Hallamos una alta asociación (OR= 5.1; IC95% 1.9-13.6) entre APOE ε4 y EA en la serie de casos de inicio tardío y con agregación familiar en 24 sujetos (28.9%). Una asociación negativa, estadísticamente significativa, fue encontrada entre ε2 y EA (OR= 0.2; IC95% 0.05-0.75). Conclusión: En Colombia son necesarios futuros estudios con base poblacional para poder precisar la existencia o no de un efecto de dosis de APOE ε4.PALABRAS-CLAVES: enfermedad de Alzheimer, APOE, demencia, factores de riesgo, grupos étnicos, Colombia.

show abstract

Section: Discussionmentioning

confidence: 99%

APOE epsilon4 and Alzheimer's disease: positive association in a Colombian clinical series and review of the Latin-American studies

Jacquier

Arango

Villareal

et al. 2001

Arq. Neuro-Psiquiatr.

View full text Add to dashboard Cite

show abstract

“…29 Genomic DNA was amplified with the primers PSEN1-S 5 0 AACAGCTCAGGAGAGGAATG 3 0 and PSEN1-AS 5 0 GATGAGACAAGTNCCNTGAA 3 0 . We used the restriction enzyme BsmI for restriction fragment length polymorphism analysis.…”

Section: Genetic Analysismentioning

confidence: 99%

Cortical atrophy in presymptomatic Alzheimer's disease presenilin 1 mutation carriers

Quiroz

Stern

Reiman

et al. 2012

Journal of Neurology, Neurosurgery & Psychiatry

View full text Add to dashboard Cite

Background Sporadic late-onset Alzheimer’s disease (AD) dementia has been associated with a ‘signature’ of cortical atrophy in paralimbic and heteromodal association regions measured with MRI. Objective To investigate whether a similar pattern of cortical atrophy is present in presymptomatic presenilin 1 E280A mutation carriers an average of 6 years before clinical symptom onset. Methods 40 cognitively normal volunteers from a Colombian population with familial AD were included; 18 were positive for the AD-associated presenilin 1 mutation (carriers, mean age=38) whereas 22 were non-carriers. T1-weighted volumetric MRI images were acquired and cortical thickness was measured. A priori regions of interest from our previous work were used to obtain thickness from AD-signature regions. Results Compared to non-carriers, presymptomatic presenilin 1 mutation carriers exhibited thinner cortex within the AD-signature summary measure (p<0.008). Analyses of individual regions demonstrated thinner angular gyrus, precuneus and superior parietal lobule in carriers compared to non-carriers, with trend-level effects in the medial temporal lobe. Conclusion Results demonstrate that cognitively normal individuals genetically determined to develop AD have a thinner cerebral cortex than non-carriers in regions known to be affected by typical late-onset sporadic AD. These findings provide further support for the hypothesis that cortical atrophy is present in preclinical AD more than 5 years prior to symptom onset. Further research is needed to determine whether this method could be used to characterise the age-dependent trajectory of cortical atrophy in presymptomatic stages of AD.

show abstract

“…A more detailed description of the Paisas has been published elsewhere. [41][42][43][44][45] Racial admixture estimations, 43 evolutionary reconstruction using phylogenetic methods, 44,46 genotyping of specific chromosomal Y and mitochondrial markers 46 and the presence of strong founder effects for some deleterious mutations resulting in neurodegenerative diseases, such as Early Onset Alzheimer Disease (PS-1 E280A), CADASIL (notch3 C455R) and Parkinson Disease (Parkin Cys212Tyr), [47][48][49][50][51][52] all support the conclusion that this community exhibits the features of a genetic isolate.…”

Section: Sample Ascertainment and Clinical Diagnosismentioning

confidence: 99%

Pedigree disequilibrium test (PDT) replicates association and linkage between DRD4 and ADHD in multigenerational and extended pedigrees from a genetic isolate

et al. 2004

View full text Add to dashboard Cite

Association/linkage between dopamine D4 receptor (DRD4) polymorphisms and attentiondeficit/hyperactivity disorder (ADHD) has been suggested by case-control-and nuclear-familybased studies. Here, we present a candidate gene analysis for DRD4 using 14 extended and multigenerational families segregating ADHD derived from the 'Paisa' community of Antioquia, Colombia, a genetic isolate. Two DRD4 polymorphisms (a 120 bp tandem duplication at the promoter and a 48 bp-VNTR at exon 3), reported associated to ADHD, were genotyped. Parametric and non-parametric linkage analyses, and a family-based association test (FBAT), the pedigree disequilibrium test (PDT), were applied to search for evidence of association/ linkage. Two-point LOD scores were significantly negative, with values ranging from À3.21 (P ¼ 0.011158) to À7.66 (P ¼ 0.000091 at h ¼ 0). Non-parametrical analysis resulted in nonsignificant evidence for linkage. The PDT showed a moderate trend toward significance of association/linkage between the 7-repeat (7R) allele at the 48 bp VNTR and ADHD (P ¼ 0.0578). Furthermore, the haplotype analysis shows a significant association/linkage of the 7R-240 bp haplotype (P ¼ 0.0467) with ADHD. Results suggest that either a moderate DRD4 genetic effect, or linkage disequilibrium of DRD4 with an ADHD disease locus in the vicinity or the linkage to a phenotypic component of the ADHD spectrum could be underlying this association/linkage. These results provide further evidence for the association of ADHD to genetic variation in or near to DRD4 and replicate the previously reported association between ADHD and the 7R allele.

show abstract

E280A PS‐1 mutation causes Alzheimer's disease but age of onset is not modified by ApoE alleles

Cited by 25 publications

References 0 publications

APOE epsilon4 and Alzheimer's disease: positive association in a Colombian clinical series and review of the Latin-American studies

APOE epsilon4 and Alzheimer's disease: positive association in a Colombian clinical series and review of the Latin-American studies

Cortical atrophy in presymptomatic Alzheimer's disease presenilin 1 mutation carriers

Pedigree disequilibrium test (PDT) replicates association and linkage between DRD4 and ADHD in multigenerational and extended pedigrees from a genetic isolate

Contact Info

Product

Resources

About