DNA reference libraries of French Guianese mosquitoes for barcoding and metabarcoding

Abstract

The mosquito family (Diptera: Culicidae) constitutes the most medically important group of arthropods because certain species are vectors of human pathogens. In some parts of the world, the diversity is so high that the accurate delimitation and/or identification of species is challenging. A DNA-based identification system for all animals has been proposed, the so-called DNA barcoding approach. In this study, our objectives were (i) to establish DNA barcode libraries for the mosquitoes of French Guiana based on the COI and the 16S markers, (ii) to compare distance-based and tree-based methods of species delimitation to traditional taxonomy, and (iii) to evaluate the accuracy of each marker in identifying specimens. A total of 266 specimens belonging to 75 morphologically identified species or morphospecies were analyzed allowing us to delimit 86 DNA clusters with only 21 of them already present in the BOLD database. We thus provide a substantial contribution to the global mosquito barcoding initiative. Our results confirm that DNA barcodes can be successfully used to delimit and identify mosquito species with only a few cases where the marker could not distinguish closely related species. Our results also validate the presence of new species identified based on morphology, plus potential cases of cryptic species. We found that both COI and 16S markers performed very well, with successful identifications at the species level of up to 98% for COI and 97% for 16S when compared to traditional taxonomy. This shows great potential for the use of metabarcoding for vector monitoring and eco-epidemiological studies.

DNA barcodes and evidence of cryptic diversity of anthropophagous mosquitoes in Quintana Roo, Mexico

“…Ae. serratus formed well‐defined paraphyletic clades (Figure ) including both the sequences generated in this study (clade QROO) and the sequences from the database belonging to specimens collected by Talaga et al () in French Guiana (clade FG) (Supporting Information Appendix ). Hameagogus equinus formed a paraphyletic clade, eight sequences (CUL072‐13, CUL079‐13, CUL078‐13, MRRO048‐16, MRRO215‐16, MRRO216‐16, MRRO217‐16, and MRRO221‐16) formed clade QROO‐A supported by a 98% bootstrap value, and other isolated clade (QROO‐B) that included the sequences CUL076‐13, CUL077‐13, and MRRO220‐16, and a third clade (QROO‐C) formed by a single sequence MRRO218‐16.…”

“…Ae. serratus formed welldefined paraphyletic clades (Figure 3) including both the sequences generated in this study (clade QROO) and the sequences from the database belonging to specimens collected by Talaga et al (2017) in French Guiana (clade FG) (Supporting Information Appendix S1). by a single sequence MRRO218-16.…”

DNA barcoding for identification of anuran species in the central region of South America

“…The success of identification was evaluated using the “nearest-neighbor” criterion (also known as “Best match” (BM)), “Best Close Match” (BCM) and “BOLD Identification Criterion” (BIC) analysis using the SPecies IDentity and Evolution (SPIDER v. 1.3) ( Brown et al, 2012 ) in the R program ( R Development Core Team, 2020 ). An in-depth description of each analysis can be found in Talaga et al (2017) and Lavinia et al (2017) .…”

iDNA screening: Disease vectors as vertebrate samplers

“…We extracted DNA from each engorged female using a without‐boiling Chelex protocol (Casquet, Thebaud, & Gillespie, ). Two PCR were then performed: the first to amplify the Ins16S_1 marker (Ins16S_1‐F: TRRGACGAGAAGACCCTATA; Ins16S_1‐R: TCTTAATCCAACATCGAGGTC; Clarke, Soubrier, Weyrich, & Cooper, ), which allows species‐level identifications of mosquitoes and sand flies (Kocher et al., ; Talaga, Leroy, et al., ); the second to amplify the 12S‐V5 marker (12S‐V5‐F: TAGAACAGGCTCCTCTAG; 12S‐V5‐R: TTAGATACCCCACTATGC; Riaz et al., ), that was shown to provide accurate identifications of mammals (Kocher et al., ). The 12S‐V5 marker was designed for metabarcoding of vertebrates.…”