DNA‐binding properties of the overexpressed recombinant estrogen receptor α

Abstract

Estrogen receptor cr was overexpressed in COS-7 cells by transformation of an expression vector with the full length open reading frame of the receptor 0t. The nuclear estradiol-receptor complex and the soluble receptor from the COS-7 cells were cross-linked with an estrogen response element (ERE), which was substituted with 5-bromo-2'-deoxyuridine (BrdUVRE), as the receptor dimers by UV irradiation. In gel retardation analysis, the specific bindings of both nuclear and soluble receptors to ERE were decreased with increasing of KCI concentration compared with 0.1 M KC1. The ionic interactions of both receptors with ERE are thought to be similar.

Transcriptional Suppression of the Estrogen Receptor by Truncated Estrogen Receptor-Alpha

“…A wild-type 56-base-pair synthetic oligonucleotide containing a Xenopus vitellogenin A2 ERE (VRE) was prepared as mentioned previously [14,15]. Briefly, the synthetic oligonucleotides 5¢AAGCTTAACTGTCCAAAGTCAGGTCACAGTGACCTG3¢ and 5¢GAATTCACATTAACTTTGATCAGGTCACTGTGACCTG3¢ (the underlined sequences express consensus ERE) were annealed.…”

“…pCH110 was also co-transfected to normalize the amount of cellular extracts as an internal standard. The cellular extracts were incubated with [ 33 P]VRE, electrophoresed through non-denaturing polyacrylamide gel electrophoresis (PAGE) (5.6 %), and autoradiographed with a Bio-image Analyzer BAS2000 (Fuji film Co., Tokyo, Japan) as described previously [14,15].…”