DNA barcoding of fruit flies associated with cucurbit ecosystem and combination of Cue-Lure and Methyl Eugenol in trap is not effective for mass trapping of responsive fruit flies

Arya, Varun; Narayana, Srinivasa; Tyagi, Saniya; Raju, Samantapudi Venkata Satyanarayana; Srivastava, Chandra Prakash; Sinha, Twinkle; Divekar, Pratap A.

doi:10.1007/s12600-022-01003-4

Cited by 8 publications

(16 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Morphological identification of thrips: The thrips were identified using the characters presented in research papers (Rachana et al, 2021 andTyagi et al, 2022) and certain key characters presented in scanning electron images (Hulagappa et al, 2022). Out of the ten specimens examined, all ten found to be females.…”

Section: Resultsmentioning

confidence: 99%

“…The COI is having faster evolution rate than the nuclear genes (Medina and Walsh, 2000), allows discrimination of closely related species as well as phylo-geographic species within a single species. Now COI is a well-established gene in animal phyla to study molecular systematics (Twinkle et al, 2020), genetic diversity and migration (Tyagi et al, 2022;Narayana et al, 2020) discrimination of closely related taxa (Hebert et al, 2003;Monti et al, 2005), phylogenetic studies (Wells et al, 2007) development of species specific markers (Asokan et al, 2007;Sun et al, 2016). Therefore, we used COI gene sequence based quick identification of thrips infesting chilli in Varanasi and Mirzapur districts of Uttar Pradesh.…”

Section: S499mentioning

confidence: 99%

“…The PCR was performed to amplify the universal Barcode gene, COI using the primers such as LCO1490(52-GGTCAACAAATCATAAAGATATTGG-32) and HCO 2198(52TAAACTTCAGGGTGACCAAAA AATCA-32) designed by Folmer et al, 1994. The PCR mixture and thermo cyclic conditions were followed as per the protocol of Tyagi et al (2022). Later, the quality of amplified products were checked using Nanodrop Spectrometer.…”

Section: Dna Extraction Pcr and Sequencingmentioning

confidence: 99%

“…Later, the sequence was submitted to NCBI and accession number (OQ255621) was obtained. The COI gene is a wellestablished gene used for species identification, evolutionary studies, systematics in Arthropoda because of low sequence divergence within the species but high sequence divergence between the species and mitochondrial in origin (Harvey et al, 2003;Arya et al, 2022). The neighbor joining (NJ) phylogenetic tree was constructed using Scirtothrips dorsalis as an out group.…”

Section: Molecular Identification and Phylogenetic Analysis Of Thrips...mentioning

confidence: 99%

See 3 more Smart Citations

First report of invasive thrips, Thrips parvispinus (Karny) infestation on chilli from Eastern part of India

Sethy¹,

Narayana²,

Twinkle³

et al. 2023

EEC

View full text Add to dashboard Cite

The South East Asian thrips, Thrips parvispinus (Karny) was first reported in India on Papaya in 2015 later it spread to many host plants such as cowpea, Dahlia rosea, cotton etc. The severe infestation on chilli was reported from southern states during last two years and the extent of loss was more than 50 percent. Therefore, a quick roving survey was conducted to monitor the thrips infestation in chilli at farmer fields of Varanasi and Mirzapur districts of Uttar Pradesh, India. The molecular barcoding of thrips infesting chilli at Varanasi and Mirzapur district of Uttar Pradesh confirmed to be the species as Thrips parvispinus. Therefore, it’s a first report of extended distribution to eastern part of India (Uttar Pradesh). The average number of thrips per three leaves and per flower was 9.1 and 3.1 in Varanasi while in Mirzapur it was 9.3 and 5.1 respectively. The T. parvispinus attained pest status in eastern part of India. The neighbor joining tree indicated certain level of genetic diversity in the species reported from different host plants. Farmers complained about severe crop loss and failure of many insecticides to control them, it may be attributed insecticide resistance

show abstract

Section: Resultsmentioning

confidence: 99%

Section: S499mentioning

confidence: 99%

Section: Dna Extraction Pcr and Sequencingmentioning

confidence: 99%

Section: Molecular Identification and Phylogenetic Analysis Of Thrips...mentioning

confidence: 99%

See 2 more Smart Citations

First report of invasive thrips, Thrips parvispinus (Karny) infestation on chilli from Eastern part of India

Sethy¹,

Narayana²,

Twinkle³

et al. 2023

EEC

View full text Add to dashboard Cite

show abstract

“…(Haq et al 2018). C-L is known as a natural product, except as hydrolyzed derivatives, and attracts a greater population of male fruit flies Zeugodacus cucurbitae and B. dorsalis (Arya et al 2022).…”

Section: Introductionmentioning

confidence: 99%

Diversity and abundance of fruit flies (Diptera: Tephritidae) on different host plants in Depok and Bogor Districts, West Java, Indonesia

Tarno

Octavia²,

Himawan³

et al. 2022

Biodiversitas

View full text Add to dashboard Cite

Abstract. Tarno H, Octavia E, Himawan T, Setiawan Y. 2022. Detection of fruit flies (Diptera: Tephritidae) Using Cue-Lure and Methyl Eugenol in Steiner Traps in Depok City and Bogor District, West Java, Indonesia. Biodiversitas 23: 4202-4208. Fruit flies (Diptera: Tephritidae) are one of the most economically important insect pests worldwide. Two types of attractants are recommended for monitoring and controlling fruit flies: methyl eugenol (ME) and cue-lure (CL). The objective of this study was to investigate the species richness and abundance of fruit flies (Diptera: Tephritidae) using methyl eugenol (ME) and cue-lure (CL) in Depok City and Bogor District, West Java, Indonesia. The study was conducted in three sites of fruit orchards in Bogor District i.e., Malay apple (Syzygium malaccense), Lemon (Citrus limon), Papaya (Carica papaya) and two sites of fruit orchards in Depok District i.e., carambola (Averrhoa carambola) and guavas (Psidium guajava). Male fruit flies were trapped using Steiner traps baited with methyl eugenol (ME) and cue-lure (CL). There were 11 fruit fly species collected from this study i.e., Bactrocera albistrigata, B. carambolae, B. dorsalis, B. neocognata, B. umbrosa, B. verbascifoliae, Dacus conopsoides, D. longicornis, Zeugodacus calumniata, Z. caudatus, and Z. cucurbitae. In this study, B. was , D. conopsoides, D. longicornis, and Z. caudatus were only collected in Steiner traps baited with CL and B. dorsalis and B. umbrosa also only responded to ME. During sampling periods, 20,217 male adult fruit flies were collected. The highest relative abundance attracted to ME was B. carambolae and CL was Z. cucurbitae. In this study, B. albistrigata, B. calumniate, D. longicornis, Z. caudatus and Z. cucurbitae were significantly more attracted to CL than ME. Whereas, B. carambolae, B. dorsalis, B. umbrosa, and B. verbascifoliae were significantly more attracted to ME than CL. Our study showed also did not find invasive species in Depok City and Bogor District, West Java, Indonesia. Our study can be used as a method for monitoring and controlling fruit flies, namely Steiner trap with CL for Z. cucurbitae and Steiner trap with ME for B. carambolae, B. dorsalis and B. umbrosa in Depok City and Bogor District, West Java, Indonesia.

show abstract

Preparation and indoor virulence determination of a temperature‐sensitive insecticide against Zeugodacus cucurbitae (Coquillett)

Wang,

Ni,

Peng

et al. 2024

Arch Insect Biochem Physiol

View full text Add to dashboard Cite

Zeugodacus cucurbitae (Coquillett) is an important fruit and vegetable pest, especially in high‐temperature seasons. In our previous research, we developed a temperature‐sensitive sustained‐release attractant for Z. cucurbitae, that not only can control the release rate of cuelure according to the temperature change, but also shows an excellent trapping effect on Z. cucurbitae. To further enhance the killing effect of the temperature‐sensitive attractant on Z. cucurbitae, this study proposed using it in combination with an insecticide to prepare a temperature‐sensitive insecticide for Z. cucurbitae. Based on the controlled release technology of pesticides, a temperature‐sensitive Z. cucurbitae insecticide was developed by using PNIPAM gel as a temperature‐sensitive switch to carry both cuelure and insecticide at the same time. In addition, the lethal effect of different pesticides on Z. cucurbitae were tested by indoor toxicity test, and the best pesticide combination was screened out. The temperature‐sensitive insecticide prepared in this study not only had excellent thermal response and controlled release ability, but also enhanced its toxicological effects on Z. cucurbitae because it contained insecticides. Among them, combining thiamethoxam and clothianidin with the temperature‐sensitive attractants was the most effective, and their lethality reached more than 97% against Z. cucurbitae. This study is not only of great practical significance for the monitoring and controlling Z. cucurbitae, but also provides theoretical basis and reference value for the combination of temperature‐sensitive attractant and insecticide.

show abstract

DNA barcoding of fruit flies associated with cucurbit ecosystem and combination of Cue-Lure and Methyl Eugenol in trap is not effective for mass trapping of responsive fruit flies

Cited by 8 publications

References 62 publications

First report of invasive thrips, Thrips parvispinus (Karny) infestation on chilli from Eastern part of India

First report of invasive thrips, Thrips parvispinus (Karny) infestation on chilli from Eastern part of India

Diversity and abundance of fruit flies (Diptera: Tephritidae) on different host plants in Depok and Bogor Districts, West Java, Indonesia

Preparation and indoor virulence determination of a temperature‐sensitive insecticide against Zeugodacus cucurbitae (Coquillett)

Contact Info

Product

Resources

About