Divalent lead cations induce cyclooxygenase-2 gene expression by epidermal growth factor receptor/nuclear factor-kappa B signaling in A431carcinoma cells

Chou, Yii Her; Woon, Peng Yeong; Huang, Wenmin; Shiurba, Robert; Tsai, Yao Ting; Wang, Yu Shiuan; Hsieh, Tusty‐Jiuan; Chang, Wen Chang; Chuang, Hung‐Yi; Chang, Wei Chiao

doi:10.1016/j.toxlet.2011.03.017

Cited by 20 publications

(30 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This causes an elevated PGE 2 secretion. Consistently, Chou et al [47] showed that low lead ion concentrations induce inflammation by increasing COX-2 gene expression via the EGFR/NF-κB signal transduction pathway in A431 carcinoma cells. Lead exposure may also be associated with altered levels of interleukin-6, interleukin-10 or tumour necrosis factor-alpha [48, 49].…”

Section: Discussionmentioning

confidence: 63%

The Effect of Occupational Lead Exposure on Blood Levels of Zinc, Iron, Copper, Selenium and Related Proteins

Kasperczyk

Prokopowicz

Dobrakowski

et al. 2012

Biol Trace Elem Res

View full text Add to dashboard Cite

The study objective was to evaluate the effect of occupational lead exposure on blood concentrations of zinc, iron, copper, selenium and proteins related to them, such as transferrin, caeruloplasmin and haptoglobin. The examined group consisted of 192 healthy male employees of zinc–lead works. By the degree of lead exposure, the exposed group was subdivided into three subgroups. The control group was composed of 73 healthy male administrative workers. The markers of lead exposure (blood levels of lead and zinc protoporphyrin) were significantly elevated in the exposed group compared with the control group. Additionally, concentrations of copper and caeruloplasmin were raised. The significant increase in haptoglobin level was observed only in the low exposure group. Selenium levels were significantly decreased, whereas iron, zinc and transferrin levels were unchanged in the exposed group compared with the control group. There were positive correlations between the lead toxicity parameters and the copper and caeruloplasmin levels. In conclusion, the effect of occupational exposure to lead on the metabolism of trace metals appears to be limited. However, significant associations between lead exposure and levels of copper and selenium were shown. Changed levels of positive acute-phase proteins, such as caeruloplasmin and haptoglobin, were also observed.

show abstract

Section: Discussionmentioning

confidence: 63%

The Effect of Occupational Lead Exposure on Blood Levels of Zinc, Iron, Copper, Selenium and Related Proteins

Kasperczyk

Prokopowicz

Dobrakowski

et al. 2012

Biol Trace Elem Res

View full text Add to dashboard Cite

show abstract

“…The mechanism of lead-induced carcinogenesis is also unclear, but it was suggested to be related to the ability of lead to inhibit DNA synthesis or repair, as well as to induce oxidative damage [146, 147]. The majority of published articles focued on the inflammatory reaction of Pb in vivo and in vitro, and indicated that lead is capable of inducing inflammatory reactions in various cell types [148–151]. …”

Section: Methodsmentioning

confidence: 99%

Functional role of inorganic trace elements in angiogenesis part III: (Ti, Li, Ce, As, Hg, Va, Nb and Pb)

Saghiri

Orangi²,

Asatourian³

et al. 2016

Critical Reviews in Oncology/Hematology

View full text Add to dashboard Cite

Many essential elements exist in nature with significant influence on human health. Angiogenesis is vital to developmental, repair, and regenerative processes, and its aberrant regulation contributes to pathogenesis of many diseases including cancer. Thus, it is of great importance to explore the role of these elements in such a vital process. This is third in a series of reviews that serve as an overview of the role of inorganic elements in regulation of angiogenesis and vascular function. Here we will review the roles of titanium, lithium, cerium, arsenic, mercury, vanadium, niobium, and lead in these processes. The roles of other inorganic elements in angiogenesis were discussed in part I and part II of these series. The methods of exposure, structure, mechanisms, and potential activities of these elements are briefly discussed. An electronic search was performed on the role of these elements in angiogenesis from January 2005-April 2014. These elements can promote and/or inhibit angiogenesis through different mechanisms. The anti-angiogenic effect of titanium dioxide nanoparticles comes from the inhibition of angiogenic processes, and not from its toxicity. Lithium affects vasculogenesis but not angiogenesis. Nanoceria treatment inhibited tumor growth by inhibiting angiogenesis. Vanadium treatment inhibited cell proliferation and induced cytotoxic effects through interactions with DNA. The negative impact of Mercury on cell migration and tube formation activities was dose and time dependent. Lead induced IL-8 production, which is known to promote tumor angiogenesis. Thus, understanding the impact of these elements on angiogenesis will help in development of new modalities to modulate angiogenesis under various conditions.

show abstract

“…A reverse-transcriptase reaction was performed on 1 lg of extracted total RNA using a reverse-transcriptase reaction kit (Invitrogen) according to the manufacturer's instructions. Complementary (c)DNA was used to determine the IL-8 gene expression level relative to a housekeeping b-actin gene as described previously (Chou et al, 2011). IL-8 primers (sense, CAGAGACAGCAGAGCACAC and antisense, AGTTCTTTAGCACTCCTTGGC) and b-actin primers (sense, ATCTCCTTCTGCATCCTGTCGGCAAT and antisense, CATGGAGTCCTGGCATCCACGAAAC) were used in the polymerase chain reaction (PCR).…”

Section: Reverse-transcription Polymerase Chain Reactionmentioning

confidence: 99%

Involvement of L‐type Ca²⁺ channel and toll‐like receptor‐4 in nickel‐induced interleukin‐8 gene expression

Lin

Chung

Wong

et al. 2014

Environmental Toxicology

Self Cite

View full text Add to dashboard Cite

The metal nickel (Ni(2+)) is found everywhere in our daily lives, including coins, costume jewelry, and even nuts and chocolates. Nickel poisoning can cause inflammatory reactions, respiratory diseases, and allergic contact dermatitis. To clarify the mechanism by which nickel induces mediators of inflammation, we used the human acute monocytic leukemia THP-1 cell line as a model. Interleukin (IL)-8 promoter activity as well as gene expression were tested by luciferase assay and real-time polymerase chain reaction. The underlying mechanisms of nickel-induced IL-8 were investigated. We found that nickel induced IL-8 gene expression via the L-type Ca(2+) channel, Toll-like receptor-4 (TRL-4) and nuclear factor NF-κB signal transduction pathways. Nickel activated NF-κB expression through extracellular signal-regulated kinase 1/2 phosphorylation and then increased IL-8 expression. Thus, the L-type Ca(2+) channel and TRL-4 play important roles in nickel-induced inflammatory gene expressions.

show abstract

Divalent lead cations induce cyclooxygenase-2 gene expression by epidermal growth factor receptor/nuclear factor-kappa B signaling in A431carcinoma cells

Cited by 20 publications

References 25 publications

The Effect of Occupational Lead Exposure on Blood Levels of Zinc, Iron, Copper, Selenium and Related Proteins

The Effect of Occupational Lead Exposure on Blood Levels of Zinc, Iron, Copper, Selenium and Related Proteins

Functional role of inorganic trace elements in angiogenesis part III: (Ti, Li, Ce, As, Hg, Va, Nb and Pb)

Involvement of L‐type Ca²⁺ channel and toll‐like receptor‐4 in nickel‐induced interleukin‐8 gene expression

Contact Info

Product

Resources

About

Divalent lead cations induce cyclooxygenase-2 gene expression by epidermal growth factor receptor/nuclear factor-kappa B signaling in A431carcinoma cells

Cited by 20 publications

References 25 publications

The Effect of Occupational Lead Exposure on Blood Levels of Zinc, Iron, Copper, Selenium and Related Proteins

The Effect of Occupational Lead Exposure on Blood Levels of Zinc, Iron, Copper, Selenium and Related Proteins

Functional role of inorganic trace elements in angiogenesis part III: (Ti, Li, Ce, As, Hg, Va, Nb and Pb)

Involvement of L‐type Ca2+ channel and toll‐like receptor‐4 in nickel‐induced interleukin‐8 gene expression

Contact Info

Product

Resources

About

Involvement of L‐type Ca²⁺ channel and toll‐like receptor‐4 in nickel‐induced interleukin‐8 gene expression