Distinct TLR-mediated pathways regulate house dust mite–induced allergic disease in the upper and lower airways

Ryu, Ji Hwan; Yoo, Joon; Kim, Min Ji; Hwang, Sang Gyu; Ahn, Kwang Chul; Ryu, Jae Chan; Mi-Ja, Choi; Joo, Jae Hong; Kim, Chang Hoon; Lee, Sang-Nam; Lee, Won Jae; Kim, Jaesang; Shin, Dong Min; Kweon, Mi Na; Bae, Yun Soo; Yoon, Joo Heon

doi:10.1016/j.jaci.2012.07.050

Cited by 129 publications

(129 citation statements)

References 45 publications

Supporting

Mentioning

124

Contrasting

Unclassified

Order By: Relevance

“…CCL20 is one of the principal chemokines expressed by activated BECs (19)(20)(21), and HDM has been regarded as a specific stimulus for CCL20 secretion from the airway epithelium, because the production of CCL20 was substantial compared to the production of other stimuli-treated cells (43). In our present analyses, we showed that intracellular clusterin negatively regulates the secretion of CCL20 from BECs.…”

Section: Discussionsupporting

confidence: 52%

“…Although the exact mechanism underlying CCL20 induction by HDM remains to be clarified, it was reported recently that oxidative stress regulates HDM-induced epithelial cell activation, which leads to CCL20 production (19)(20)(21). In addition, recent studies associated elevated oxidative stress with the initiation of inflammatory signaling cascades and pathogenesis of asthma (22)(23)(24).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Clusterin Modulates Allergic Airway Inflammation by Attenuating CCL20-Mediated Dendritic Cell Recruitment

Hong

Kwon

Moon

et al. 2016

The Journal of Immunology

View full text Add to dashboard Cite

Recruitment and activation of dendritic cells (DCs) in the lungs are critical for Th2 responses in asthma, and CCL20 secreted from bronchial epithelial cells (BECs) is known to influence the recruitment of DCs. Because asthma is a disease that is closely associated with oxidative stress, we hypothesized that clusterin, an oxidative stress regulatory molecule, may have a role in the development of allergic airway inflammation. The aim of this study was to examine whether clusterin regulates CCL20 production from the BECs and the subsequent DC recruitment in the lungs. To verify the idea, clusterin knockout (Clu−/−), clusterin heterogeneous (Clu+/−), and wild-type mice were exposed intranasally to house dust mite (HDM) extract to induce allergic airway inflammation. We found that the total number of immune cells in bronchoalveolar lavage fluid and the lung was increased in Clu−/− and Clu+/− mice. Of these immune cells, inflammatory DCs (CD11b+CD11c+) and Ly6Chigh monocyte populations in the lung were significantly increased, which was accompanied by increased levels of various chemokines, including CCL20 in bronchoalveolar lavage fluid, and increased oxidative stress markers in the lung. Moreover, HDM-stimulated human BECs with either up- or downregulated clusterin expression showed that CCL20 secretion was negatively associated with clusterin expression. Interestingly, clusterin also reduced the level of intracellular reactive oxygen species, which is related to induction of CCL20 expression after HDM stimulation. Thus, the antioxidant property of clusterin is suggested to regulate the expression of CCL20 in BECs and the subsequent recruitment of inflammatory DCs in the airway.

show abstract

Section: Discussionsupporting

confidence: 52%

mentioning

confidence: 99%

Clusterin Modulates Allergic Airway Inflammation by Attenuating CCL20-Mediated Dendritic Cell Recruitment

Hong

Kwon

Moon

et al. 2016

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…Allergy to house dust mite is one of the most common allergic responses worldwide (56). In the case of house dust mite, there are several allergens that have protease activity (Der p 1, Der p 3, Der p 6, Der p 9) and a capacity to bind to lipids (Der p 2) (6,57,58). Der p 2 activates the TLR4 signaling pathway by acting as a MD2 mimetic and induces sensitization in a TLR4-dependent manner that is dependent on presence of LPS within the preparation (5).…”

Section: Discussionmentioning

confidence: 99%

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Tordesillas¹,

Goswami²,

Benedé³

et al. 2014

J. Clin. Invest.

192

208

View full text Add to dashboard Cite

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

show abstract

“…Thus, an ROS source other than a NOX enzyme may be required for hyperoxia-induced inflammation. Meanwhile, previous work has demonstrated that DUOX2-generated ROS play an essential role in the innate immune response to bacterial or allergenic challenge in airway epithelial cells, leading to mucosal or allergic inflammation, respectively (6,12,17,20,23,26,27,37,42). This suggests that different NOX enzymes may specifically activate distinct signaling pathways by modulating their expression level (10,35), subcellular localization (7), and interaction with membrane proteins (26,42) in a signaldependent manner.…”

Section: Discussionmentioning

confidence: 99%

“…In addition, DUOXs are expressed in epithelial cells of various tissues, including the airways, alveoli, salivary glands, intestinal tract, and prostate (16-19, 21, 47). Recent studies have focused on the role of DUOX-generated ROS in the regulation of innate immune responses in airway epithelial cells (6,20,26,27,37,42). Using DUOX2 mutant mice or mice in which DUOX2 gene expression has been suppressed in lung epithelium, we determined its specific role in the type II AECs that regulate hyperoxia-induced ALI.…”

Section: Introductionmentioning

confidence: 99%

Dual Oxidase 2 in Lung Epithelia Is Essential for Hyperoxia-Induced Acute Lung Injury in Mice

Kim

Ryu

Kwon

et al. 2014

Antioxidants & Redox Signaling

Self Cite

View full text Add to dashboard Cite

Aims: Acute lung injury (ALI) induced by excessive hyperoxia has been employed as a model of oxidative stress imitating acute respiratory distress syndrome. Under hyperoxic conditions, overloading quantities of reactive oxygen species (ROS) are generated in both lung epithelial and endothelial cells, leading to ALI. Some NADPH oxidase (NOX) family enzymes are responsible for hyperoxia-induced ROS generation in lung epithelial and endothelial cells. However, the molecular mechanisms of ROS production in type II alveolar epithelial cells (AECs) and ALI induced by hyperoxia are poorly understood. Results: In this study, we show that dual oxidase 2 (DUOX2) is a key NOX enzyme that affects hyperoxia-induced ROS production, particularly in type II AECs, leading to lung injury. In DUOX2 mutant mice (DUOX2 thyd/thyd ) or mice in which DUOX2 expression is knocked down in the lungs, hyperoxia-induced ALI was significantly lower than in wild-type (WT) mice. DUOX2 was mainly expressed in type II AECs, but not endothelial cells, and hyperoxia-induced ROS production was markedly reduced in primary type II AECs isolated from DUOX2 thyd/thyd mice. Furthermore, DUOX2-generated ROS are responsible for caspase-mediated cell death, inducing ERK and JNK phophorylation in type II AECs. Innovation: To date, no role for DUOX2 has been defined in hyperoxia-mediated ALI despite it being a NOX homologue and major ROS source in lung epithelium. Conclusion: Here, we present the novel finding that DUOX2-generated ROS induce AEC death, leading to hyperoxia-induced lung injury.

show abstract

Distinct TLR-mediated pathways regulate house dust mite–induced allergic disease in the upper and lower airways

Cited by 129 publications

References 45 publications

Clusterin Modulates Allergic Airway Inflammation by Attenuating CCL20-Mediated Dendritic Cell Recruitment

Clusterin Modulates Allergic Airway Inflammation by Attenuating CCL20-Mediated Dendritic Cell Recruitment

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Dual Oxidase 2 in Lung Epithelia Is Essential for Hyperoxia-Induced Acute Lung Injury in Mice

Contact Info

Product

Resources

About