Distinct responses of soil bacterial and fungal communities to changes in fertilization regime and crop rotation

Ai, Chao; Zhang, Shuiqing; Zhang, Xin; Guo, Doudou; Zhou, Wei; Huang, Shaomin

doi:10.1016/j.geoderma.2018.01.010

Cited by 232 publications

(113 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…As also found previously, bacterial communities appeared to be more affected by fertilizer treatments than fungal communities [73]. The changes we observed in response to fertilizer could also be linked with the level of disease suppression (Fig.…”

Section: Impact Of Biocontrol Agent On the Resident Soil Community Assupporting

confidence: 87%

Bio-organic fertilizers stimulate indigenous soil Pseudomonas populations to enhance plant disease suppression

Tao

Xiong

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Plant diseases caused by fungal pathogen result in a substantial economic impact on the global food and fruit industry. Application of organic fertilizers supplemented with biocontrol microorganisms ( i.e. bioorganic fertilizers) has been shown to improve resistance against plant pathogens at least in part due to impacts on the structure and function of the resident soil microbiome. However, it remains unclear whether such improvements are driven by the specific action of microbial inoculants, microbial populations naturally resident to the organic fertilizer or the physical-chemical properties of the compost substrate. The aim of this study was to seek the ecological mechanisms involved in the disease suppressive activity of bio-organic fertilizers. Results: To disentangle the mechanism of bio-organic fertilizer action, we conducted an experiment tracking Fusarium wilt disease of banana and changes in soil microbial communities over three growth seasons in response to the following four treatments: bio-organic fertilizer (containing Bacillus amyloliquefaciens W19), organic fertilizer, sterilized organic fertilizer and sterilized organic fertilizer supplemented with B. amyloliquefaciens W19. We found that sterilized bioorganic fertilizer to which Bacillus was re-inoculated provided a similar degree of disease suppression as the non-sterilized bioorganic fertilizer across cropping seasons. We further observed that disease suppression in these treatments is linked to impacts on the resident soil microbial communities, specifically by leading to increases in specific Pseudomonas spp.. Observed correlations between Bacillus amendment and indigenous Pseudomonas spp. that might underlie pathogen suppression were further studied in laboratory and pot experiments. These studies revealed that specific bacterial taxa synergistically increase biofilm formation and likely acted as a plant-beneficial consortium against the pathogen. Conclusion: Together we demonstrate that the action of bioorganic fertilizer is a product of the biocontrol inoculum within the organic amendment and its impact on the resident soil microbiome. This knowledge should help in the design of more efficient biofertilizers designed to promote soil function.

show abstract

Section: Impact Of Biocontrol Agent On the Resident Soil Community Assupporting

confidence: 87%

Bio-organic fertilizers stimulate indigenous soil Pseudomonas populations to enhance plant disease suppression

Tao

Xiong

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…High-throughput sequencing technologies had provided important ways to determine microbial information in recent years, and many studies had generated more valuable soil microbial information through experiments involving long-term fertilization practices. However, most had focused on dryland soil agro-ecosystems 16 – 19 , just a few studies had reported microbial community characteristics in paddy soils. For example, the study by Daquiado et al .…”

Section: Introductionmentioning

confidence: 99%

Long-term combined application of manure and chemical fertilizer sustained higher nutrient status and rhizospheric bacterial diversity in reddish paddy soil of Central South China

Chen

Yang-zhu

Gao

et al. 2018

Sci Rep

View full text Add to dashboard Cite

Bacteria, as the key component of soil ecosystems, participate in nutrient cycling and organic matter decomposition. However, how fertilization regime affects the rhizospheric bacterial community of reddish paddy soil remains unclear. Here, a long-term fertilization experiment initiated in 1982 was employed to explore the impacts of different fertilization regimes on physicochemical properties and bacterial communities of reddish paddy rhizospheric soil in Central South China by sequencing the 16S rRNA gene. The results showed that long-term fertilization improved the soil nutrient status and shaped the distinct rhizospheric bacterial communities. Particularly, chemical NPK fertilizers application significantly declined the richness of the bacterial community by 7.32%, whereas the application of manure alone or combined with chemical NPK fertilizers significantly increased the biodiversity of the bacterial community by 1.45%, 1.87% compared with no fertilization, respectively. Moreover, LEfSe indicated that application of chemical NPK fertilizers significantly enhanced the abundances of Verrucomicrobia and Nitrospiraceae, while manure significantly increased the abundances of Deltaproteobacteria and Myxococcales, but the most abundant Actinobacteria and Planctomycetes were detected in the treatment that combined application of manure and chemical NPK fertilizers. Furthermore, canonical correspondence analysis (CCA) and the Mantel test clarified that exchangeable Mg2+ (E-Mg2+), soil organic carbon (SOC) and alkali-hydrolyzable nitrogen (AN) are the key driving factors for shaping bacterial communities in the rhizosphere. Our results suggested that long-term balanced using of manure and chemical fertilizers not only increased organic material pools and nutrient availability but also enhanced the biodiversity of the rhizospheric bacterial community and the abundance of Actinobacteria, which contribute to the sustainable development of agro-ecosystems.

show abstract

“…Fungal primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATC GATGC) were used to amplify ITS1 region of rDNA 16 . Bacterial 16S rDNA was amplified with primers 338 F (ACTCCTACGGGAGGCAGCA) and 806 R (GGACTACHVGGGTWTCTAAT) 17 . The PCR products were purified and sequenced with Illumina MiSeq.…”

Section: Dna Extraction Amplification Of Its and 16 Rdna Region And mentioning

confidence: 99%

Ganoderma lucidum cultivation affect microbial community structure of soil, wood segments and tree roots

Ren

Zhang

et al. 2020

Sci Rep

View full text Add to dashboard Cite

The popular medicinal mushroom Ganoderma lucidum (Fr.) Karst. [Ling Zhi] has been widely used for the general promotion of health and longevity in Asian countries. Continuous cultivation may affect soil microbe and soil properties. However, the effect of G. lucidum cultivation on related wood segments, soil and tree roots microbial communities and soil properties is remain unknown. In our study, the microbial communities of soils, wood segments, and tree roots before and after G. lucidum cultivation were investigated by Illumina Miseq sequencing of both ITS and 16S rDNA, and taxonomic composition of eukaryotic and prokaryotic microorganisms were observed. Indices of microbial richness, diversity and evenness significantly differed between before and after G. lucidum cultivation. Each of the investigated sampling type harbored a distinctive microbial community and differed remarkably before and after G. lucidum cultivation. Ascomycota and Basidiomycota (fungi), Proteobacteria and Actinobacteria (bacteria) showed significant differences after Ling Zhi cultivation. The soil property values also changed after cultivation. The redundancy analysis (RDA) showed that both the fungal and bacterial community structure significantly correlated with soil humus, pH, nitrogen, carbon and trace elements (Fe, Zn, Mn, Cu) contents. The results indicated that G. lucidum cultivation may have significant differed the associated microbial community structures and soil properties. The study will provide useful information for G. lucidum cultivation and under-forest economic development.

show abstract

Distinct responses of soil bacterial and fungal communities to changes in fertilization regime and crop rotation

Cited by 232 publications

References 62 publications

Bio-organic fertilizers stimulate indigenous soil Pseudomonas populations to enhance plant disease suppression

Bio-organic fertilizers stimulate indigenous soil Pseudomonas populations to enhance plant disease suppression

Long-term combined application of manure and chemical fertilizer sustained higher nutrient status and rhizospheric bacterial diversity in reddish paddy soil of Central South China

Ganoderma lucidum cultivation affect microbial community structure of soil, wood segments and tree roots

Contact Info

Product

Resources

About