Distinct Lineage of Vesiculovirus from Big Brown Bats, United States

Ng, Terry Fei Fan; Driscoll, Cindy; Carlos, Maria P.; Prioleau, Algernon; Schmieder, Robert; Dwivedi, Bhakti; Wong, Jakk; Cha, Yunhee; Head, Steven R.; Breitbart, Mya; Delwart, Eric

doi:10.3201/eid1912.121506

Cited by 22 publications

(25 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the absence of a definitive diagnosis for the skin lesions, metagenomic sequencing was performed on seven lip lesions and one nonlesioned lip, according to previously described protocols, to further investigate a potential underlying viral etiology (21)(22)(23)(24). In brief, a tissue homogenate was centrifuged through a 0.22-m filter to enrich viral particles by size and then treated with nucleases to deplete host nucleic acids.…”

Section: Methodsmentioning

confidence: 99%

“…Tissues from 40 bluegills, three related Lepomis species, and one largemouth bass were extracted using Qiagen DNA extraction kits. Screening for BGHBV was accomplished by traditional PCR, targeting the polymerase with the primer set BGHBV-PolF (5=-TGTGGACAAAAATCCACGAA-3=) and BGHBV-PolR (5=-CGTAAAGCACCTATGGGCAT-3=), using a previously described touchdown protocol (21). Additional primers targeting the polymerase, capsid, and core proteins were also designed and verified (Table 2).…”

Section: Methodsmentioning

confidence: 99%

“…Nucleic acids from nuclease-resistant viral particles were extracted using the QIAquick viral-RNA column purification system, followed by sequence-independent amplification using random priming. First-strand synthesis (for both DNA and RNA) was performed with a 28-base oligonucleotide whose 3= end consisted of eight random nucleotides (primer N1_8N, CCTTGAAGGCGGACTGTGAGNNNNNNNN), using Superscript III reverse transcriptase (Invitrogen) (21)(22)(23)(24). A second strand was synthesized using Klenow fragment DNA polymerase (New England BioLabs).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Distinct Viral Lineages from Fish and Amphibians Reveal the Complex Evolutionary History of Hepadnaviruses

Dill

Camus

Leary

et al. 2016

J Virol

Self Cite

View full text Add to dashboard Cite

Hepadnaviruses (hepatitis B viruses [HBVs]) are the only animal viruses that replicate their DNA by reverse transcription of an RNA intermediate. Until recently, the known host range of hepadnaviruses was limited to mammals and birds. We obtained and analyzed the first amphibian HBV genome, as well as several prototype fish HBVs, which allow the first comprehensive comparative genomic analysis of hepadnaviruses from four classes of vertebrates. Bluegill hepadnavirus (BGHBV) was characterized from in-house viral metagenomic sequencing. The African cichlid hepadnavirus (ACHBV) and the Tibetan frog hepadnavirus (TFHBV) were discovered using in silico analyses of the whole-genome shotgun and transcriptome shotgun assembly databases. Residues in the hydrophobic base of the capsid (core) proteins, designated motifs I, II, and III, are highly conserved, suggesting that structural constraints for proper capsid folding are key to capsid protein evolution. Surface proteins in all vertebrate HBVs contain similar predicted membrane topologies, characterized by three transmembrane domains. Most striking was the fact that BGHBV, ACHBV, and the previously described white sucker hepadnavirus did not form a fish-specific monophyletic group in the phylogenetic analysis of all three hepadnaviral genes. Notably, BGHBV was more closely related to the mammalian hepadnaviruses, indicating that cross-species transmission events have played a major role in viral evolution. Evidence of cross-species transmission was also observed with TFHBV. Hence, these data indicate that the evolutionary history of the hepadnaviruses is more complex than previously realized and combines both virus-host codivergence over millions of years and host species jumping. IMPORTANCEHepadnaviruses are responsible for significant disease in humans (hepatitis B virus) and have been reported from a diverse range of vertebrates as both exogenous and endogenous viruses. We report the full-length genome of a novel hepadnavirus from a fish and the first hepadnavirus genome from an amphibian. The novel fish hepadnavirus, sampled from bluegills, was more closely related to mammalian hepadnaviruses than to other fish viruses. This phylogenetic pattern reveals that, although hepadnaviruses have likely been associated with vertebrates for hundreds of millions of years, they have also been characterized by species jumping across wide phylogenetic distances. The Hepadnaviridae are characterized by extremely small (3-to 3.3-kbp), partially double-stranded DNA (dsDNA) genomes. The viral particles are spherical, with a diameter of approximately 42 nm, each containing a single copy of the genome covalently linked to the viral reverse transcriptase (RT), which provides DNA polymerase activity (1-3). The hepadnaviruses are unique among animal viruses in that they replicate their DNA by reverse transcription of an RNA intermediate and comprise the only group VII animal virus (dsDNA-RT virus) of the Baltimore system, which classifies viruses according to their genome composit...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Distinct Viral Lineages from Fish and Amphibians Reveal the Complex Evolutionary History of Hepadnaviruses

Dill

Camus

Leary

et al. 2016

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…Briefly, deep sequencing using Illumina Miseq and the 454 Genome Sequencer FLX platform was performed on enriched viral particles from the tissue according to previously described protocols in which both viral DNA and RNA were randomly amplified and sequenced [16, 18]. Sequences were analyzed by a customized pipeline in which de novo assembly was performed, and the resulting contigs and the unassembled singlets were compared against the GenBank database using BLASTx and BLASTn [16, 17]. Over 1,800 Miseq sequences and 30 pyrosequences were mapped to a picornavirus coding sequence.…”

mentioning

confidence: 99%

A tortoise-infecting picornavirus expands the host range of the family Picornaviridae

Wellehan

Coleman

et al. 2015

Arch Virol

Self Cite

View full text Add to dashboard Cite

While picornaviruses can cause diseases in many mammals, little is known of their host range for replication in non-mammalian vertebrates. Here, a picornavirus in liver and kidney tissues from diseased Sulawesi tortoises (Indotestudo forsteni) was genetically characterized. Tortoise rafivirus A (ToRaV-A, KJ415177) represents a potential new genus in the family Picornaviridae, for which we propose the name “Rafivirus”. Our finding confirms the susceptibility of reptiles to picornaviruses.

show abstract

“…Three sets of overlapping consensus primers covering the 5′ NTR-VP1, VP1−2C, and 2C-3′NTR regions (TTAAAACAGCYTTGGGGTTGT [1 to 21] and GCTGATTTATCACTGTGCGAGTT [2544 to 2522]; AACTTGGTGTGGTCCCTAGC [2446 to 2465] and CCTTTCTTTTGGCAATAATCC [5134 to 5114]; and TCTCAAGAAGTTAGGGATTATTGC [5100 to 5123] and GGCCCCCAAGTGACCAAAAT [7333 to 7314] [coordinates per GenBank KT285485]) were used to amplify the genome of EV-D68. Three RT-PCRs were performed, using the One-Step RT-PCR Kit (Qiagen) on each RNA sample with a “touch-down” protocol (4). For each sample the three amplicons were pooled, purified, and subjected to Nextera XT (Illumina) library preparation, followed by sequencing using the Illumina MiSeq platform.…”

Section: Genome Announcementmentioning

confidence: 99%

Detection and Genomic Characterization of Enterovirus D68 in Respiratory Samples Isolated in the United States in 2016

Montmayeur

Castro

et al. 2016

Genome Announc

Self Cite

View full text Add to dashboard Cite

show abstract

Distinct Lineage of Vesiculovirus from Big Brown Bats, United States

Cited by 22 publications

References 14 publications

Distinct Viral Lineages from Fish and Amphibians Reveal the Complex Evolutionary History of Hepadnaviruses

Distinct Viral Lineages from Fish and Amphibians Reveal the Complex Evolutionary History of Hepadnaviruses

A tortoise-infecting picornavirus expands the host range of the family Picornaviridae

Detection and Genomic Characterization of Enterovirus D68 in Respiratory Samples Isolated in the United States in 2016

Contact Info

Product

Resources

About