Discovery of a selective inhibitor of doublecortin like kinase 1

Ferguson, Fleur M.; Nabet, Behnam; Raghavan, Srivatsan; Liu, Yan; Leggett, Alan L.; Kuljanin, Miljan; Kalekar, Radha L.; Yang, Annan; He, Shuning; Wang, Jinhua; Ng, Raymond W.S.; Sulahian, Rita; Li, Lianbo; Poulin, Emily J.; Huang, Ling; Koren, Jošt Vrabič; Diéguez-Martínez, Nora; Espinosa, Sergio; Zeng, Zhiyang; Corona, Cesear; Vasta, James D.; Ohi, Ryoma; Sim, Taebo; Kim, Nam Doo; Harshbarger, Wayne; Lizcano, José M.; Robers, Matthew B.; Muthaswamy, Senthil; Lin, Charles Y.; Look, A. Thomas; Haigis, Kevin M.; Mancias, Joseph D.; Wolpin, Brian M.; Aguirre, Andrew J.; Hahn, William C.; Westover, Kenneth D.; Gray, Nathanael S.

doi:10.1038/s41589-020-0506-0

Cited by 91 publications

(128 citation statements)

References 56 publications

Supporting

Mentioning

121

Contrasting

Order By: Relevance

“…1b-c). These effects were recapitulated in PATU-8902 LACZ-FKBP12 F36V cells, 17 corroborating effective degradation of FKBP12 F36V -fusions in a pancreatic ductal adenoma carcinoma (PDAC) context (Supplementary Fig. 1e).…”

Section: Resultssupporting

confidence: 62%

“…22 To confirm the utility of dTAG V -1 for target validation, we evaluated KRAS G12V degradation, an oncogenic driver of PDAC, in PATU-8902 FKBP12 F36V -KRAS G12V ; KRAS -/- cells. 17 dTAG V -1 treatment led to rapid KRAS G12V degradation, which was rescued by use of dTAG V -1-NEG, pre-treatment with proteasome-inhibitor (carfilzomib) or Nedd8 activating enzyme inhibitor (MLN4924), and VHL knockout, consistent with the mechanism of action of a VHL-recruiting degrader (Fig. 1f-g and Supplementary Fig.…”

Section: Resultsmentioning

confidence: 55%

“…Studies degrading oncoproteins, transcription and chromatin regulators, and kinases exemplify the utility of the dTAG system for drug target validation and discovery. 6, 11-17 Despite this broad applicability, we observed context- and protein-specific differences in the effectiveness of dTAG-13 for inducing target protein degradation. Here, we report the synthesis, characterization and utility of a second generation, in vivo -compatible dTAG molecule that recruits the von Hippel-Lindau (VHL) E3 ligase complex, dTAG V -1 (BNN-01-004) (Fig.…”

Section: Introductionmentioning

confidence: 90%

“…Cloning of pLEX_305-dTAG-KRAS G12V and pLEX_305-LACZ-dTAG were previously described. 6, 17 To generate pLEX_305-dTAG-GFP and pLEX_305-dTAG-EWS/FLI gateway recombination cloning strategies (Invitrogen) were employed. First, EWS/FLI was cloned into pDONR221 using BP clonase (Invitrogen) after PCR with the following primers containing BP overhangs: Forward-N-E/F-dTAG, 5’- ggggacaagtttgtacaaaaaagcaggcttcgcgtccacggattacagtacct-3’ and Reverse-N-E/F-dTAG, 5’- ggggaccactttgtacaagaaagctgggtcctagtagtagctgcctaagtgtgaaggc-3’.…”

Section: Methodsmentioning

confidence: 99%

“…Cloning of pXPR007-sgGFP and pXPR007-sgKRAS were previously described. 17 To generate lentiCRISPR v2-Blast-sgFLI_Ex9, sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites. The PAM motif of sgFLI_Ex9 is present in an intron, enabling cutting of the endogenous locus only with cDNA rescue.…”

Section: Methodsmentioning

confidence: 99%

See 4 more Smart Citations

Rapid and direct control of target protein levels with VHL-recruiting dTAG molecules

Nabet

Ferguson

Seong

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

35Chemical biology strategies for directly perturbing protein homeostasis including the 36 degradation tag (dTAG) system provide temporal advantages over genetic approaches and 37 improved selectivity over small molecule inhibitors. We describe dTAG V -1, an exclusively 38 selective VHL-recruiting dTAG molecule, to rapidly degrade FKBP12 F36V -tagged proteins. 39 dTAG V -1 overcomes a limitation of previously reported CRBN-recruiting dTAG molecules to 40 degrade recalcitrant oncogenes, supports combination degrader studies and facilitates 41 investigations of protein function in cells and mice. 42 43 We next evaluated the utility of dTAG V -1 for combinatorial degrader studies. dTAG V -1 94 was effectively combined with THAL-SNS-032, a previously reported CRBN-recruiting CDK9 95 degrader 21 (Fig. 1e). Pronounced degradation of LACZ-FKBP12 F36V and CDK9 was observed to 96 levels comparable to those with treatment of each degrader alone, avoiding potential substrate 97 competition effects. 22 To confirm the utility of dTAG V -1 for target validation, we evaluated 98 KRAS G12V degradation, an oncogenic driver of PDAC, in PATU-8902 FKBP12 F36V -KRAS G12V ;; 99 KRAS -/cells. 17 dTAG V -1 treatment led to rapid KRAS G12V degradation, which was rescued by 100 use of dTAG V -1-NEG, pre-treatment with proteasome-inhibitor (carfilzomib) or Nedd8 activating 101 enzyme inhibitor (MLN4924), and VHL knockout, consistent with the mechanism of action of a 102 VHL-recruiting degrader ( Fig. 1f-g and Supplementary Fig. 2a-b). We also observed the 103 expected collapse in cellular signaling and diminished cell proliferation in 2D-monolayer and 3D-104 spheroid cultures upon FKBP12 F36V -KRAS G12V degradation with dTAG V -1 treatment, to levels 105 comparable to CRBN-recruiting dTAG molecules ( Fig. 1h and Supplementary Fig. 2c-e). 106To confirm the in vivo applicability of dTAG V -1, we characterized the pharmacokinetic 107 (PK) and pharmacodynamic (PD) profile of dTAG V -1 in mice. dTAG V -1 demonstrated improved 108properties compared to dTAG-13, with a longer half-life (T1/2 = 4.43, 2.41 h respectively) and 109 greater exposure (AUCinf = 18517, 6140 hr*ng mL -1 respectively) by intraperitoneal 110 administration at 10 mg/kg ( Supplementary Table 1). To report on the PD profile of dTAG 111 molecules, we employed MV4;;11 luciferase-FKBP12 F36V (luc-FKBP12 F36V ) cells 6 that allow non-112 invasive monitoring of bioluminescent signal upon dTAG molecule administration in mice. 113Following tail vein injection of MV4;;11 luc-FKBP12 F36V cells and establishment of leukemic 114 burden, we performed daily bioluminescent measurements 4 h after vehicle, 35 mg/kg dTAG-13 115 or 35 mg/kg dTAG V -1 administration. Striking loss of bioluminescent signal was achieved 4 h 116 after the first administration of dTAG V -1 ( Fig. 1i and Supplementary Fig. 3). Consistent loss of 117 bioluminescent signal was observed 4 h after each of the three dTAG-13 or dTAG V -1 118 administrations. Compared to dTAG-13, improved duration of degradation w...

show abstract

Section: Resultssupporting

confidence: 62%

Section: Resultsmentioning

confidence: 55%

Section: Introductionmentioning

confidence: 90%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Rapid and direct control of target protein levels with VHL-recruiting dTAG molecules

Nabet

Ferguson

Seong

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

Strategies for Tag‐Based Protein Control

Nabet¹,

Gray²,

Ferguson³

2022

Protein Homeostasis in Drug Discovery

View full text Add to dashboard Cite

Charting a New Path Towards Degrading Every Protein

Nabet

2020

ChemBioChem

Self Cite

View full text Add to dashboard Cite

Strategies to directly alter protein abundance such as small‐molecule‐induced targeted protein degradation (TPD) are innovative pharmacological modalities with promising clinical potential. Herein, I describe my experience with the development of the degradation tag (dTAG) system, which is a chemical biology strategy to induce rapid and precise degradation of any target protein. Open‐source collaborative discovery has been critical for advancing the versatility and accessibility of the dTAG system and will be necessary to understand the benefits and limits of TPD‐based strategies in the clinic.

show abstract

Discovery of a selective inhibitor of doublecortin like kinase 1

Cited by 91 publications

References 56 publications

Rapid and direct control of target protein levels with VHL-recruiting dTAG molecules

Rapid and direct control of target protein levels with VHL-recruiting dTAG molecules

Strategies for Tag‐Based Protein Control

Charting a New Path Towards Degrading Every Protein

Contact Info

Product

Resources

About