Direct sequencing of RNA with MinION Nanopore: detecting mutations based on associations

Abstract

One of the key challenges in the field of genetics is the inference of haplotypes from next generation sequencing data. The MinION Oxford Nanopore sequencer allows sequencing long reads, with the potential of sequencing complete genes, and even complete genomes of viruses, in individual reads. However, MinION suffers from high error rates, rendering the detection of true variants difficult. Here, we propose a new statistical approach named AssociVar, which differentiates between true mutations and sequencing errors from direct RNA/DNA sequencing using MinION. Our strategy relies on the assumption that sequencing errors will be dispersed randomly along sequencing reads, and hence will not be associated with each other, whereas real mutations will display a non-random pattern of association with other mutations. We demonstrate our approach using direct RNA sequencing data from evolved populations of the MS2 bacteriophage, whose small genome makes it ideal for MinION sequencing. AssociVar inferred several mutations in the phage genome, which were corroborated using parallel Illumina sequencing. This allowed us to reconstruct full genome viral haplotypes constituting different strains that were present in the sample. Our approach is applicable to long read sequencing data from any organism for accurate detection of bona fide mutations and interstrain polymorphisms.

Determining the Suitability of MinION’s Direct RNA and DNA Amplicon Sequencing for Viral Subtype Identification

“…For the RNA libraries, Canu corrected reads for this analysis because of the lower q score filter needed to obtain sufficient data. The SNP callers used included: AssociVar (v1 [ 29 ]), iVar (v1.0.1 [ 30 ]), Ococo (v0.1.2.7 [ 31 ]), and FreeBayes (v1.3.1 [ 32 ]). iVar was run without base quality alignment and the following filters: a minimum base and mapping quality of 20, a minimum variant quality score of 30, and a frequency of 0.2.…”

Competition between social cheater viruses is driven by mechanistically different cheating strategies

“…Illumina MiSeq library preparation and read alignment were performed as described in (44). Briefly, the MS2 RNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific), using 3R primer (TGGGTGGTAACTAGCCAAGCAG).…”

“…The Oxford Nanopore MinION was used to directly sequence the MS2 RNA genome. We sequenced p15A and p15B in separate runs, as described in detail in (44). Alignment was performed using BLAST with parameters of minimal percent identity of 60 and E-value threshold of 1 × 10 −7 to allow the highly variable MinION reads to map.…”

“…Alignment was performed using BLAST with parameters of minimal percent identity of 60 and E-value threshold of 1 × 10 −7 to allow the highly variable MinION reads to map. We inferred strains and divided the population accordingly, as described in (44), by haplotype/strain identification analysis using the mutations appearing in Fig. 1A.…”

Direct oligonucleotide sequencing with nanopores

“…Oxford Nanopore Technologies, with its biological nanopore-based sequencing technology, has opened the market wide open by releasing a $1000 sequencing platform -The MinION [1]. The MinION platform has the capability to sequence both amplified and non-amplified double-stranded DNA (dsDNA) [2] and direct RNA in the 3' to 5' direction using Poly-A tail capture [3]. Direct sequencing of short, singlestranded oligonucleotides has been regarded as a challenge due to nanopore chemistry, pore design and basecalling [4], however, attempts have been made to overcome these challenges by performing circularization [5].…”