Direct Induction of Apoptosis Using an Optimal Mitochondrially Targeted p53

Abstract

Targeting the tumor suppressor p53 to the mitochondria triggers a rapid apoptotic response as efficiently as transcription-dependent p53.1, 2 p53 forms a complex with the anti-apoptotic Bcl-XL, which leads to Bak and Bax oligomerization resulting in apoptosis via mitochondrial outer membrane permeabilization.3, 4 Although p53 performs its main role in the mitochondrial outer membrane it also interacts with different proteins in the mitochondrial inner membrane and matrix.5, 6 To further investigate mitochondrial activity of p53, EGFP-p53 was fused to different mitochondrial targeting signals (MTSs) directing it to the mitochondrial outer membrane (“XL-MTS” from Bcl-XL; “TOM-MTS” from TOM20), the inner membrane (“CCO-MTS” from cytochrome c oxidase) or matrix (“OTC-MTS” from ornithine transcarbamylase). Fluorescence microscopy and a p53 reporter dual luciferase assay demonstrated that fusing MTSs to p53 increased mitochondrial localization and nuclear exclusion depending on which MTS was used. To examine if the MTSs initiate mitochondrial damage, we fused each individual MTS to EGFP (a non-toxic protein) as negative controls. We performed caspase-9, TUNEL, Annexin-V, and 7-AAD apoptosis assays on T47D breast cancer cells transfected with mitochondrial constructs. Except for EGFP-XL, apoptotic potential was observed in all MTS-EGFP-p53 and MTS-EGFP constructs. In addition, EGFP-p53-XL showed the greatest significant increase in programmed cell death compared to its non-toxic MTS control (EGFP-XL). The apoptotic mechanism for each construct was further investigated using pifithrin-α (an inhibitor of p53 transcriptional activity), pifithrin-μ (a small molecule that reduces binding of p53 to Bcl-2 and Bcl-XL), and over-expressing the anti-apoptotic Bcl-XL. Unlike the MTSs from TOM, CCO, and OTC, which showed different apoptotic mechanisms, we conclude that p53 fused to the MTS from Bcl-XL performs its apoptotic potential exclusively through p53/Bcl-XL specific pathway.

Heterologous Src Homology 4 Domains Support Membrane Anchoring and Biological Activity of HIV-1 Nef

“…6C) revealed that this heterologous organelle targeting approach was effective: revGlc-Nef⌬SH4.GFP localized to the perinuclear region, TOM20-Nef⌬SH4.GFP showed the tubular pattern typically observed for mitochondrial proteins (66,67), and Pex13-Nef⌬SH4.GFP displayed a dot-like distribution within the cytoplasm consistent with targeting to peroxisomes. In fixed Jurkat TAg cells, the different OT Nef.GFP proteins showed subcellular localizations similar to those observed in live HeLa cells (Fig.…”

Delivery of a Monomeric p53 Subdomain with Mitochondrial Targeting Signals from Pro-Apoptotic Bak or Bax

“…An oligonucleotide encoding the MTS from Bak (5′-GATCCGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTT GGGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGAG-3′) was annealed to its reverse complementary strand and fused to the C-terminus of EGFP-p53 (26) using the BamHI restriction sites (NEB, Ipswich, MA).…”

“…The annealed oligonucleotide encoding the MTS from Bak was fused to the C-terminus of EGFP-C1 vector (Clontech, Mountain View, CA) (26) using the BamHI (NEB) restriction sites.…”

“…The DNA encoding the DBD was amplified via PCR from previously subcloned pEGFP-p53 (26) using 5′-CCGGGCCCGCGGTCCGGAACCTACCAGGGCAGCTACG-3′ and 5′-CCGGGCCCGCGGGGTACCTTTCTTGCGGAGATTCTCTTCCT and cloned between EGFP and Bak MTS into the multiple cloning site of E-BakMTS using BspEI (NEB) and KpnI (NEB) sites.…”

“…To stain the mitochondria, cells were incubated with 150 nM of MitoTracker Red FM (Invitrogen) for 15 min at 37°C and protected from light prior to imaging. All images of 1471.1 and T47D live cells were acquired as previously (26, 27) with an Olympus IX71F fluorescence microscope (Scientific Instrument Company, Aurora, CO) with high quality (HQ) narrow band GFP filter (ex, HQ480/20 nm; em, HQ510/20 nm) and HQ:TRITC filter (ex, HQ545/30; em, HQ620/60) from Chroma Technology (Brattleboro, VT) with a 40× PlanApo oil immersion objective (NA 1.00) on an F-View Monochrome CCD camera.…”