Differential innate responses of chickens and ducks to low-pathogenic avian influenza

Abstract

Ducks and chickens are hosts of avian influenza virus, each with distinctive responses to infection. To understand these differences, we characterized the innate immune response to low-pathogenicity avian influenza virus H7N1 infection in chickens and ducks. Viral RNA was detected in the lungs of chickens from day 0.8 to 7, in ducks mainly at day 4. In both species, viral RNA was detected in the bursa and gut. Infection in chickens resulted in up-regulation of interferon (IFN)-α and IFN-β mRNA, while in the ducks IFN-γ mRNA was strongly up-regulated in the lung and bursa. In chickens and ducks, all investigated pathogen recognition receptor (PRR) mRNAs were up-regulated; however, in the chicken lung Toll-like receptor (TLR)7 and melanoma differentiation-associated protein (MDA)-5 mRNA were strongly induced. TLR3, TLR7 and MDA-5 responses correlated with IFN-α and IFN-β responses in chickens, but in ducks a correlation between IFN-α and TLR7, retinoic acid-inducible gene-I and MDA-5 was absent. We studied the responses of duck and chicken splenocytes to poly(I:C) and R848 analogues to analyse the regulation of PRRs without the interfering mechanisms of the influenza virus. This revealed IFN-α and IFN-γ responses in both species. MDA-5 was only strongly up-regulated in chicken splenocytes, in which time-related PRR responses correlated with the IFN-α and IFN-β response. This correlation was absent in duck splenocytes. In conclusion, chickens and ducks differ in induction of MDA-5, TLR7 and IFN-α mRNA after an influenza virus infection in vivo and after in vitro stimulation with TLR antagonists.

Different outcomes of infection of chickens and ducks with a duck-origin H9N2 influenza A virus

“…In addition, a recent study revealed that Muscovy ducks (Cairina moschata) mounted overall stronger innate immune response to H9N2 infection than chickens (Huang et al, 2012). Several studies have demonstrated that expression of immune-related genes varied with different types of ducks, different origins of AIV isolates and different tissues Cornelissen et al, 2012;Maughan et al, 2013). Furthermore, age-related differences in immune responses to AIV infection have also reported in chickens and ducks (Reemers et al, 2010;Pantin-Jackwood et al, 2012).…”

Differences in highly pathogenic avian influenza viral pathogenesis and associated early inflammatory response in chickens and ducks

“…Perhaps the lack of the TLR7 response in the brain and lung of H7N1-infected chickens is related to an inadequate innate response of the host to clear the virus infection. TLR7 may contribute to influenza virus recognition and in chickens and ducks in the PRR's mRNA induction and consequently the induction of cytokine mRNA may influence the host's ability to control HPAI avian influenza, as was found for low-pathogenic avian influenza-infected chickens (Cornelissen et al, 2012).…”

“…For the quantification, a standard curve of a plasmid containing the cytokine gene of interest in pGEM-T easy (Promega Benelux b.v., Leiden, the Netherlands) was used. Primer sequences for real-time PCR used in this study have been described by Cornelissen et al (2012). The primer pairs for duck and chicken inducible nitric oxide synthase (iNOS) gene (forward, CCACCAGGAGATGTTGAATATGTC; reverse, CCA-GATGTGTGTTTTCCATGCA) have been described by Burggraaf et al (2011).…”

“…was detected in the lung (Rebel et al, 2011), although high levels of the IFN-inducible genes Mx and PKR were found in the lung of H5N1-infected chickens (Daviet et al, 2009). The production of cytokines after a virus infection is mediated by pathogen recognition receptors (PRRs), including Toll-like receptors (TLRs) and RIG-I-like receptors (Kawai & Akira, 2008;Diebold, 2009) Induction of these receptors has been studied in lowpathogenic avian influenza infections in both chickens and ducks (Volmer et al, 2011;Karpala et al, 2011b;Cornelissen et al, 2012;Liniger et al, 2012). Barber et al (2010) reported the absence of RIG-I in chickens and suggested that the severity of HPAI infection in chickens may be explained by the absence of RIG-I activity.…”

Epidemiological investigations on the role of clinically healthy racing pigeons as a reservoir for avian paramyxovirus-1 and avian influenza virus

“…As AIV preferentially binds to α-2,3-linked sialic acids (Rogers et al, 1983), we may expect reduced AIV susceptibility of the pigeon. Furthermore, the innate immune response of the host may affect its susceptibility for the establishment of AIV infection (Cornelissen et al, 2012). Different to chickens, pigeons-like ducks, which exhibit a certain natural resistance to AIV-possess the retinoic acid-inducible gene I, which triggers a strong antiviral interferon response (Barber et al, 2010) possibly controlling AIV replication in a sufficient way.…”