Differential Effects of Integrinαv Knockdown and Cilengitide on Sensitization of Triple-Negative Breast Cancer and Melanoma Cells to Microtubule Poisons

Abstract

Low survival rates of patients with metastatic triple-negative breast cancer (TNBC) and melanoma, in which current therapies are ineffective, emphasize the need for new therapeutic approaches. Integrin b1 appears to be a promising target when combined with chemotherapy, but recent data have shown that its inactivation increases metastatic potential owing to the compensatory upregulation of other integrin subunits. Consequently, we analyzed the potential of integrin subunits av, a3, or a4 as targets for improved therapy in seven TNBC and melanoma cell lines. Experiments performed in an integrin avb1-negative melanoma cell line, MDA-MB-435S, showed that knockdown of integrin subunit av increased sensitivity to microtubule poisons vincristine or paclitaxel and decreased migration and invasion. In the MDA-MB-435S cell line, we also identified a phenomenon in which change in the expression of one integrin subunit changes the expression of other integrins, leading to an unpredictable influence on sensitivity to anticancer drugs and cell migration, referred to as the integrin switching effect. In a panel of six TNBCs and melanoma cell lines, the contribution of integrins av versus integrins avb3/b5 was assessed by the combined action of av-specific small interfering RNA or avb3/b5 inhibitor cilengitide with paclitaxel. Our results suggest that, for TNBC, knockdown of integrin av in combination with paclitaxel presents a better therapeutic option than a combination of cilengitide with paclitaxel; however, in melanoma, neither of these combinations is advisable because a decreased sensitivity to paclitaxel was observed.

KANK2 Links αVβ5 Focal Adhesions to Microtubules and Regulates Sensitivity to Microtubule Poisons and Cell Migration

“…In a series of experiments, the effect on sensitivity to MT poisons was ascribed to integrin αVβ5 but not to integrin αVβ3. On the other hand, both αV integrins, αVβ3 and αVβ5, were implicated in the regulation of cell migration (Stojanovic et al, 2018). In the present work, our aim was to unravel a possible link between these alterations in sensitivity to MT poisons and migration and the adhesome composition.…”

“…To construct MDA-MB-435S clones with decreased expression of integrin αV subunit, pSUPER vector system for the expression of shRNA was used (OligoEngine, United States). Briefly, oligonucleotides were constructed according to the sequence of siRNA specific for integrin subunit αV (s7568-Ambion, United States), previously used in transient transfection in the same cell model (Stojanovic et al, 2018). Oligonucleotides P1 -GATCCCCGAATATCGGTTGGATTATATTCAAGAGA TATAATCCAACCGATATTCTTTTTA and P2 -AGCTTAAA AAGAATATCGGTTGGATTATATCTCTTGAATATAATCCAA CCGATATTCGGG were annealed and cloned into HindIII (NEB, United Kingdom) and BglII (Thermo Fisher Scientific, United States) digested vector.…”

“…Integrin signaling confers resistance of cancer cells to chemotherapy (Stojanovic et al, 2016) and radiotherapy (Eke et al, 2018). Conversely, knockdown of integrins may sensitize tumor cells to both chemoand radiotherapy (Stojanovic et al, 2018;Wang et al, 2019). Therefore, integrins are promising targets to be combined with classical therapy, especially αV integrins which play non-essential roles in development but are involved in tumor growth and angiogenesis (Seguin et al, 2015).…”

“…We also identified integrin αVβ5 as a key integrin in this process. Concomitantly, we demonstrated that integrin αV knockdown decreases migration and invasion, a process in which both integrins αVβ3 and αVβ5 are involved (Stojanovic et al, 2018). Here, we aimed to identify the integrin(s) used by MDA-MB-435S cells in cell culture and to catalog changes in IAC composition upon integrin αV knockdown.…”

Role of Bcl‑2 on drug resistance in breast cancer polyploidy‑induced spindle poisons

“…Tumor chemotherapy is an important part of the comprehensive treatment for solid tumors (1). Paclitaxel, vincristine and other spindle poisons are widely used as first-line chemotherapy for various types of malignant tumor, such as breast cancer, cervical cancer and melanoma (2,3). One of the important methods in treating cancer is inducing tumor cell death.…”