Differential downregulation of Rbm5 and Rbm10 during skeletal and cardiac differentiation

Abstract

RBM5 and RBM10 play an important role in transformed cells. This role includes influencing the alternative splicing and/or expression of factors involved in apoptosis and cell cycle arrest. To date, all apoptosis studies relating to RBM5 and RBM10 have been performed in transformed cell lines, potentially confounding mechanistic interpretation because of the many mutations present in this population. The objective of this study was to identify a physiologically relevant non-transformed system in which to examine the expression of RBM5 and RBM10 for future mechanistic and target identification studies. Our system of choice was H9c2 myoblast differentiation. Expression of Rbm5, Rbm10, and selected splice variants was examined by end-point or real-time PCR and Western blot. We determined that all of the examined Rbm5 and Rbm10 variants were expressed in H9c2 myoblasts and throughout skeletal and cardiac myoblast differentiation. Furthermore, expression was differentially downregulated in a lineage-specific manner, suggesting lineage-specific regulation and roles. There was no correlation between mRNA and protein expression for Rbm5, Rbm10v1, and Rbm10v2, suggesting post-transcriptional and/or post-translational regulation. The differentiation expression profiles suggest the products encoded by Rbm5 and Rbm10 play a more important role in skeletal than cardiac myoblast differentiation and influence similar processes in non-tumor, differentiating cells as in transformed cells. The data also suggest that full-length Rbm5 and Rbm10 play a less important role than their alternative splice variants and/or shorter protein isoforms. This work establishes myoblast differentiation as a relevant model in which to conduct functional studies regarding Rbm5 and Rbm10.

RBM5 reduces small cell lung cancer growth, increases cisplatin sensitivity and regulates key transformation-associated pathways

“…Gene sets with FDR at or below 10% in control vs. C4 are presented in Table 1, along with their FDR in control vs. T2. Interestingly, many differentially expressed gene sets are important to development, which validates our experimental findings, as RBM5 was recently shown to be involved in myogenesis, spermatogenesis and neuronal development (Fushimi et al, 2008; Loiselle and Sutherland, 2014; O'Bryan et al, 2013). Furthermore, apoptosis and TNFα signaling, both pathways RBM5 has been previously associated with in Jurkat T lymphoblastoid cells (Rintala-Maki and Sutherland, 2004; Sutherland et al, 2000) and MCF-7 cells (Rintala-Maki et al, 2004) were altered in T2 and C4.…”

“…For RNA templates used in PCR, reverse transcription was performed as previously described (Loiselle and Sutherland, 2014). In regards to the Ontario Tumour Bank (OTB) tissue samples, 20 mg of tissue was cut with a sterile blade from fresh frozen tissue specimens that had been stored at −80 °C.…”

“…GAPDH was amplified using GAPDH-F (exon 6: 5′ AACACAGTCCATGCCATCAC 3′) and GAPDH-R (exon 7: 5′ TCCACCACCCTGTTGCTGTA), with an annealing temperature of 58−59 °C and 25–35 amplification cycles. PCR and product visualization were carried out as previously described (Loiselle and Sutherland, 2014). Approximate primer locations shown in Fig.…”

Nuclear Magnetic Resonance Structure of a Novel Globular Domain in RBM10 Containing OCRE, the Octamer Repeat Sequence Motif

“…RBM5- and RBM10-mediated effects in regulating mature RNA isoforms (Matera and Wang, 2014; Wahl et al, 2009) have been documented in lung adenocarcinoma (David and Manley, 2010; Imielinski et al, 2012; Sutherland et al, 2010) and in diverse developmental processes (Johnston et al, 2010; Loiselle and Sutherland, 2014). Their functions in the early spliceosome (Behzadnia et al, 2007) are to regulate pre-mRNA splicing by promoting exon skipping and alternate 5′-splice site selection in Fas and Bcl-x pre-mRNA (Bonnal et al, 2008; Inoue et al, 2014; Wang et al, 2013).…”

“…OCRE sequence motifs with five imperfect tyrosine repeats have been observed in only two other human proteins, RBM6 and AGGF1 (Callebaut and Mornon, 2005). The mechanism of action by which RBM5 and RBM10 regulate pre-mRNA processing is the subject of intensive studies, but still largely unknown (Bechara et al, 2013; Inoue et al, 2014; Loiselle and Sutherland, 2014; Ray et al, 2013; Wang et al, 2013). At this early state of work on the mechanistic basis of the RBM functionality, structure determination of RBM building blocks and their intermolecular interactions greatly contribute to the advancement of the field.…”