Diagnosis of Tuberculosis

Bates, Joseph H.

doi:10.1378/chest.76.6.757

Cited by 28 publications

(12 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Microscopic examination of acid-fast bacilli (AFB) requires the presence of at least 10 000 organisms ml À1 in the sample, while culture is more sensitive, requiring as little as 100 organisms ml À1 (Bates, 1979). However, M. tuberculosis may take up to 8 weeks to grow in LJ medium.…”

Section: Introductionmentioning

confidence: 99%

Improved diagnostic value of PCR in the diagnosis of female genital tuberculosis leading to infertility

Bhanu

Singh

Chakraborty

et al. 2005

Journal of Medical Microbiology

135

104

View full text Add to dashboard Cite

Histopathological and mycobacteriological examinations have limited utility in the diagnosis of genital tuberculosis. In this double-blind study, 61 samples, consisting of endometrial aspirates (EAs), endometrial biopsies (EBs) and fluid from the pouch of Douglas (POD), from 25 women suffering from infertility were investigated for the presence of the mpt64 gene of Mycobacterium tuberculosis by PCR and correlated with laparoscopic findings. PCR demonstrated M. tuberculosis DNA in 14 out of 25 patients (56 . 0 %), compared to one smear with acid-fast bacilli (1 . 6 %) and two culture-positive samples (3 . 2 %). The presence of M. tuberculosis DNA was observed in 53 . 3 % of EBs, 47 . 6 % of EAs and 16 . 0 % of POD fluid samples. All patients with laparoscopy suggestive of tuberculosis, 60 % of those with a probable diagnosis and 33 % of those with incidental findings were positive by PCR. However, one EA sample from an infertile patient with normal laparoscopy was also positive. Multiple sampling from different sites and amplification of the mpt64 gene segment by PCR offered increased sensitivity in determining tuberculous aetiology in female infertility.

show abstract

Section: Introductionmentioning

confidence: 99%

Improved diagnostic value of PCR in the diagnosis of female genital tuberculosis leading to infertility

Bhanu

Singh

Chakraborty

et al. 2005

Journal of Medical Microbiology

135

104

View full text Add to dashboard Cite

show abstract

“…Given the sample volume used in PCR, this corresponds to approximately 800 organisms per ml of CSF. Microscopical detection of AFB on standard ZN-stained smears usually requires between 5,000 to 10,000 organisms per ml of CSF, and a successful culture requires usually the presence of 10 to 100 mycobacteria in the sample 5 . However, a previous study 7 showed that most culture-positive CSF samples had fewer than 10 mycobacteria per ml.…”

mentioning

confidence: 99%

Low sensitivity of polymerase chain reaction for diagnosis of tuberculous meningitis in southeastern Brazil

Brienze

et al. 2001

Rev. Soc. Bras. Med. Trop.

View full text Add to dashboard Cite

Two polymerase chain reaction (PCR) protocols showed low sensitivity (36% and 53% for TB AMPLICOR and MPB64 nested PCR, respectively), when compared with classic microbiological methods (73% and 54% for Ziehl-Neelsen staining and culture, respectively), in the diagnosis of tuberculous meningitis in 91 patients in southeastern Brazil. Only three PCR-positive, microbiologically negative patients were found. Analysis of sequential cerebrospinal fluid samples by nested PCR detected Mycobacterium tuberculosis DNA up to 29 days after the introduction of antituberculosis chemotherapy. Key-words: Diagnosis of tuberculous meningitis. PCR. Mycobacterium tuberculosis.Resumo Dois protocolos de reação em cadeia da polimerase (PCR) apresentaram baixa sensibilidade (36% e 53%, respectivamente), para TB AMPLICOR e PCR aninhado baseado no gene MPB64), quando comparados aos métodos microbiológicos clássicos (73% e 54% respectivamente para baciloscopia e cultura), no diagnóstico de meningite tuberculosa em 91 pacientes do sudeste do Brasil. Somente três pacientes apresentaram PCR positiva e microbiologia negativa. A análise de amostras seqüenciais de líquor com a PCR aninhada detectou DNA de Mycobacterium tuberculosis até 29 dias após a introdução de tratamento. Palavras-chaves: Diagnóstico da meningite tuberculosa. PCR. Mycobacterium tuberculosis.

show abstract

“…For the definitive diagnosis of tuberculosis, Mycobacterium tuber culosis {M. tuberculosis) has to be isolated and identified from clinical specimens. However, it takes up to 6 to 8 weeks to recover the mycobacteria by the conventional methods (3). Therefore, when the organism can not be identified directly by the acid-fast stains, a tentative diagnosis has to be made by radiographic examinations and clinical symp toms including non-specific symptoms, such as fever, general fatigue, weight loss, and lymphadenopathies.…”

Section: Introductionmentioning

confidence: 99%

Clinical Application of the Polymerase Chain Reaction for a Rapid Diagnosis of Mycobacterium tuberculosis Infection.

et al. 1992

View full text Add to dashboard Cite

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3\ The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conven tional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

show abstract

Diagnosis of Tuberculosis

Cited by 28 publications

References 39 publications

Improved diagnostic value of PCR in the diagnosis of female genital tuberculosis leading to infertility

Improved diagnostic value of PCR in the diagnosis of female genital tuberculosis leading to infertility

Low sensitivity of polymerase chain reaction for diagnosis of tuberculous meningitis in southeastern Brazil

Clinical Application of the Polymerase Chain Reaction for a Rapid Diagnosis of Mycobacterium tuberculosis Infection.

Contact Info

Product

Resources

About