Development of pan-phlebovirus RT-PCR assay

Klimentov, Alexander S.; Butenko, A. M.; Khutoretskaya, N. V.; Shustova, Elena Y.; Larichev, Victor; Isaeva, Olga V.; Karganova, Galina G.; Lukashev, Alexander N.; Gmyl, Anatoly P.

doi:10.1016/j.jviromet.2016.02.009

Cited by 15 publications

(8 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…To confirm the presence of viral pathogens, a previously described PCR method for Phlebovirus detection [ 21 ] and qPCR method for AHFV detection [ 22 ] were used. After sequencing, we found some TOV contigs and developed a real time PCR method targeting the L segment of TOV using the forward primer 5′ACACGTTTCTTGGGAGATGC3′, reverse primer 5′GAGCTTGCGCTGCTTTTATT3′ and the probe FAM-CAAGGACCATGAGACTGCTG-BHQ.…”

Section: Methodsmentioning

confidence: 99%

Viral RNA Metagenomics of Hyalomma Ticks Collected from Dromedary Camels in Makkah Province, Saudi Arabia

Zakham

Albalawi

Alanazi

et al. 2021

Viruses

View full text Add to dashboard Cite

Arthropod-borne infections are a medical and economic threat to humans and livestock. Over the last three decades, several unprecedented viral outbreaks have been recorded in the Western part of the Arabian Peninsula. However, little is known about the circulation and diversity of arthropod-borne viruses in this region. To prepare for new outbreaks of vector-borne diseases, it is important to detect which viruses circulate in each vector population. In this study, we used a metagenomics approach to characterize the RNA virome of ticks infesting dromedary camels (Camelus dromedaries) in Makkah province, Saudi Arabia. Two hundred ticks of species Hyalomma dromedarii (n = 196) and Hyalomma impeltatum (n = 4) were collected from the Alkhurma district in Jeddah and Al-Taif city. Virome analysis showed the presence of several tick-specific viruses and tick-borne viruses associated with severe illness in humans. Some were identified for the first time in the Arabian Peninsula. The human disease-associated viruses detected included Crimean Congo Hemorrhagic fever virus and Tamdy virus (family Nairoviridae), Guertu virus (family Phenuiviridae), and a novel coltivirus that shares similarities with Tarumizu virus, Tai forest reovirus and Kundal virus (family Reoviridae). Furthermore, Alkhurma hemorrhagic virus (Flaviviridae) was detected in two tick pools by specific qPCR. In addition, tick-specific viruses in families Phenuiviridae (phleboviruses), Iflaviridae, Chuviridae, Totiviridae and Flaviviridae (Pestivirus) were detected. The presence of human pathogenetic viruses warrants further efforts in tick surveillance, xenosurveillence, vector control, and sero-epidemiological investigations in human and animal populations to predict, contain and mitigate future outbreaks in the region.

show abstract

Section: Methodsmentioning

confidence: 99%

Viral RNA Metagenomics of Hyalomma Ticks Collected from Dromedary Camels in Makkah Province, Saudi Arabia

Zakham

Albalawi

Alanazi

et al. 2021

Viruses

View full text Add to dashboard Cite

show abstract

“…A limitation of the present study is the short fragment (less than 200 bp) of the L segment used for phylogenetic analysis. However, this segment is highly conserved and is the most used for phleboviruses phylogenetic studies [21,26,27]. Subsequent studies will amplify a larger fragment of the L segment and include the detection of S and M segments, to rule out reassortment of genome segments with other Phenuivirus, in addition to the use of new technologies such as HTS, to better characterize the Colombian viruses.…”

Section: Discussionmentioning

confidence: 99%

First report of Lihan Tick virus (Phlebovirus, Phenuiviridae) in ticks, Colombia

López

Miranda

Máttar

et al. 2020

Virol J

View full text Add to dashboard Cite

Background: Tick-borne phenuivirus (TBPVs) comprise human and animal viruses that can cause a variety of clinical syndromes ranging from self-limiting febrile illness to fatal haemorrhagic fevers. Objective: Detect Phlebovirus (Family Phenuiviridae) in ticks collected from domestic animals in Córdoba, Colombia. Methods: We collected 2365 ticks from domestic animals in three municipalities of the Department of Cordoba, Colombia in 2016. Ticks were identified and pooled by species for RNA extraction. A nested real-time PCR with specific primers for Phlebovirus and a specific probe for Heartland virus (HRTV) formerly a Phlebovirus, now a Banyangvirus were performed. Also, a conventional nested PCR, with the same specific primers was used to detect other Phleboviruses, with positive reactions indicated by an amplified cDNA fragment of approximately 244 bp determined by gel electrophoresis. These bands were gel-purified and sequenced by the Sanger method. Results: Using real-time RT-PCR, no positive results for HRTV were found. However, using conventional nested PCR 2.2% (5/229 pools) yielded a product of 244 bp. One positive sample was detected in a pool of Dermacentor nitens ticks collected from a horse, and the four remaining positive pools were from Rhipicephalus microplus collected from cattle. The five positive nucleotide sequences had identities of 93 to 96% compared to a section of the Lsegment of Lihan Tick virus, a Phlebovirus originally detected in R. microplus ticks in China. The strongest identity (96-99%) was with Lihan Tick virus detected in R. microplus ticks from Brazil. Conclusions: This is the first report of viral detection in ticks in Colombia. We detected a Colombian strain of Lihan Tick virus. We recommend expanding the sampling area and carrying out more eco-epidemiological studies related to epidemiological surveillance of viruses on ticks in Colombia.

show abstract

“…In the present study, TBPV sequences detected in Colombian ticks collected form domestic animals were similar to Lihan tick virus detected in China in R. microplus ticks (23) A limitation of the present study is the short fragment (less than 200 bp) of the L segment used for phylogenetic analysis. However, this segment is highly conserved and is the most used for phleboviruses phylogenetic studies (21,26,27). Subsequent studies will amplify a larger fragment of the L segment and include the detection of S and M segments, to rule out reassortment of genome segments with other Phenuivirus, in addition to the use of new technologies such as HTS, to better characterize the Colombian viruses.…”

Section: Discussionmentioning

confidence: 99%

First report of Lihan Tick virus (Phlebovirus, Phenuiviridae) in ticks, Colombia

López¹,

Miranda²,

Mattar³

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Tick-borne phenuivirus (TBPVs) comprise human and animal viruses that can cause a variety of clinical syndromes ranging from self-limiting febrile illness to fatal haemorrhagic fevers. Objective: Detect Phlebovirus (Family Phenuiviridae) in ticks collected from domestic animals in Córdoba, Colombia. Methods: We collected 2,365 ticks from domestic animals in three municipalities of the Department of Cordoba, Colombia in 2016. Ticks were identified and pooled by species for RNA extraction. A nested real-time PCR with specific primers for Phlebovirus and a specific probe for Heartland virus (HRTV) formerly a Phlebovirus, now a Banyangvirus were performed. Also, a conventional nested PCR, with the same specific primers was used to detect other Phleboviruses , with positive reactions indicated by an amplified cDNA fragment of approximately 244 bp determined by gel electrophoresis. These bands were gel-purified and sequenced by the Sanger method. Results: Using real-time RT-PCR, no positive results for HRTV were found. However, using conventional nested PCR 2.2% (5/229 pools) yielded a product of 244 bp. One positive sample was detected in a pool of Dermacentor nitens ticks collected from a horse, and the four remaining positive pools were from Rhipicephalus microplus collected from cattle. The five positive nucleotide sequences had identities of 93 to 96% compared to a section of the L-segment of Lihan Tick virus , a Phlebovirus originally detected in R. microplus ticks in China. The strongest identity (96 -99%) was with Lihan Tick virus detected in R. microplus ticks from Brazil. Conclusions: This is the first report of viral detection in ticks in Colombia. We detected a Colombian strain of Lihan Tick virus . We recommend expanding the sampling area and carrying out more eco-epidemiological studies related to epidemiological surveillance of viruses on ticks in Colombia.

show abstract

Development of pan-phlebovirus RT-PCR assay

Cited by 15 publications

References 21 publications

Viral RNA Metagenomics of Hyalomma Ticks Collected from Dromedary Camels in Makkah Province, Saudi Arabia

Viral RNA Metagenomics of Hyalomma Ticks Collected from Dromedary Camels in Makkah Province, Saudi Arabia

First report of Lihan Tick virus (Phlebovirus, Phenuiviridae) in ticks, Colombia

First report of Lihan Tick virus (Phlebovirus, Phenuiviridae) in ticks, Colombia

Contact Info

Product

Resources

About