Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus

Liu, Peiwen; Li, Xiaocong; Gu, Jiande; Dong, Yunqiao; Liu, Yan; Puthiyakunnon, Santhosh; Chen, Xiaoguang

doi:10.1038/srep20979

Cited by 18 publications

(30 citation statements)

References 47 publications

(60 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…DNVs have small genomes, which can limit the size of the inserted transgenes and they often require wild type virus for effective viral packaging. In an elegant approach, recombinant AeDNV were engineered to express microRNAs that target host genes or to sequester host miRNA using antisense miRNA sponges (Liu et al 2016). This strategy overcomes some of the challenges associated with expressing larger genes from these viruses and enables the use of RNAi, rather than effector molecules, for vector control.…”

mentioning

confidence: 99%

Microbial control of arthropod-borne disease

Saldaña

Hegde

Hughes

2017

Mem. Inst. Oswaldo Cruz

View full text Add to dashboard Cite

Arthropods harbor a diverse array of microbes that profoundly influence many aspects of host biology, including vector competence. Additionally, symbionts can be engineered to produce molecules that inhibit pathogens. Due to their intimate association with the host, microbes have developed strategies that facilitate their transmission, either horizontally or vertically, to conspecifics. These attributes make microbes attractive agents for applied strategies to control arthropod-borne disease. Here we discuss the recent advances in microbial control approaches to reduce the burden of pathogens such as Zika, Dengue and Chikungunya viruses, and Trypanosome and Plasmodium parasites. We also highlight where further investigation is warranted.

show abstract

mentioning

confidence: 99%

Microbial control of arthropod-borne disease

Saldaña

Hegde

Hughes

2017

Mem. Inst. Oswaldo Cruz

View full text Add to dashboard Cite

show abstract

“…Additionally, MDVs can be transmitted vertically to their offspring by infected females [30–32]. We previously reported the development of a non-defective recombinant AaeDV, which can express small interference RNAs using an intronic sRNA expression strategy that lays the foundation for further enhancing the virulence of MDVs for bioinsecticide use [12, 18]. AaeDV as a product (Viroden) was evaluated in small-scale field studies in the former Soviet Union in 1979 [30].…”

Section: Discussionmentioning

confidence: 99%

“…Moreover, MDVs extend the larval stage and decrease the lifespan and body size of adults [11]. Furthermore, their pathogenicity can be significantly improved by genetic engineering techniques, such as altering the vector used to express the insect-specific toxin, gene or specific shRNA or artificial miRNA that targets genes essential for the development, growth or physiology of mosquitoes [12–14]. MDVs can be transmitted in mosquito populations through horizontal transmission in larval habitats and/or by vertical transmission.…”

Section: Introductionmentioning

confidence: 99%

Development of large-scale mosquito densovirus production by in vivo methods

Sun

Dong

et al. 2019

Parasites Vectors

Self Cite

View full text Add to dashboard Cite

Background Mosquito-borne diseases (MBDs) cause a significant proportion of the global infectious disease burden. Vector control remains the primary strategy available to reduce the transmission of MBDs. However, long-term, wide-scale and large-scale traditional chemical pesticide application has caused significant and increased negative effects on ecosystems and broader emerging insecticide resistance in vectors; therefore, the development of a novel alternative approach is urgently needed. Mosquito densoviruses (MDVs) are entomopathogenic viruses that exhibit a narrow host range and multiple transmission patterns, making MDVs a great potential bioinsecticide. However, the application process has been relatively stagnant over the past three decades. The major obstacle has been that viruses must be produced in mosquito cell lines; therefore, the production process is both expensive and time-consuming. Methods In our study, two wild-type (wt) MDVs, AaeDV and AalDV-3, and a recombinant rAaeDV-210 were used to infect the Aag2 and C6/36 mosquito cell lines and the 1st–2nd-instar and 3rd–4th-instar larvae of Ae. albopictus , Ae. aegypti and Cx. quinquefasciatus . Viral titers and yields in cells, media, larvae and rearing water and total viral yield were evaluated. Three kinds of virus displayed higher maximum virus titers in vivo than in vitro , and they displayed higher maximum viral yields in rearing water. Results The three viruses displayed higher total maximum viral yields in C6/36 cells than in Aag2 cells. The three viruses displayed higher total maximum viral yields in Aedes mosquitoes than in Culex mosquitoes. Higher viral yields were produced by 1st–2nd-instar larvae compared to 3rd–4th-instar larvae. The recombinant viruses did not display significantly lower yields than wt viruses in nearly all samples. In summary, by using 100 1st–2nd-instar Aedes mosquito larvae in 200 ml of rearing water, more than 10 13 genome equivalents (geq) MDV yield can be obtained. Conclusions Considering the lower production cost, this in vivo method has great potential for the large-scale production of MDVs. MDVs exhibit promising prospects and great potential for mosquito control in the future. Electronic supplementary material The online version of this article (10.1186/s13071-019-3509-5) contains supplementary material, which is available to authorized users.

show abstract

“…. p7NS1-DsRed expresses a non-structural protein 1 (NS1)-red fluorescent protein (DsRed) fusion protein from the p7 promoter and has been described in detail elsewhere 14 . A human-specific miR-941-1 precursor 20 and its sponge, a scrambled shRNA (CGACGACTATCGTGCAATTTCAAGAG AATTGCACGATAGTCGTCG), were also subcloned into AaeDV as a negative control.…”

mentioning

confidence: 99%

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Liu

Dong

et al. 2017

JoVE

View full text Add to dashboard Cite

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method requires a more technically demanding operation and involves complicated procedures, especially when used in larvae due to their small size, relatively thin and fragile cuticle, and high mortality, which limit its application. In contrast, viral vectors for gene delivery have been developed to surmount extracellular and intracellular barriers. These systems have the advantages of easy manipulation, high gene transduction efficiency, long-term maintenance of gene expression, and the ability to produce persistent effects in vivo. Mosquito densoviruses (MDVs) are mosquito-specific, small single-stranded DNA viruses that can effectively deliver foreign nucleic acids into mosquito cells; however, the replacement or insertion of foreign genes to create recombinant viruses typically causes a loss of packaging and/or replication abilities, which is a barrier to the development of these viruses as delivery vectors. Herein, we report using an artificial intronic small-RNA expression strategy to develop a non-defective recombinant Aedes aegypti densovirus (AaeDV) in vivo delivery system. Detailed procedures for the construction, packaging and quantitative analysis of the rAaeDV vectors, and for larval infection are described. This study demonstrates, for the first time, the feasibility of developing a non-defective recombinant MDV micro RNA (miRNA) expression system, and thus providing a powerful tool for the functional analysis of genes in mosquito and establishing a basis for the application of viral paratransgenesis for controlling mosquito-borne diseases. We demonstrated that Aedes albopictus 1 instar larvae could be easily and effectively infected by introducing the virus into the water body of the larvae breeding site and that the developed rAaeDVs could be used to overexpress or knock down the expression of a specific target gene in larvae, providing a tool for the functional analysis of mosquito genes.

show abstract

Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus

Cited by 18 publications

References 47 publications

Microbial control of arthropod-borne disease

Microbial control of arthropod-borne disease

Development of large-scale mosquito densovirus production by in vivo methods

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Contact Info

Product

Resources

About