Development of an adenoviral vector with robust expression driven by p53

Abstract

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTxbeta, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit beta-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG served as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.

AAVPG: A vigilant vector where transgene expression is induced by p53

“…The PGTxβ promoter, previously described by our group (Bajgelman and Strauss, 2008), proved to be reliable in the context of an AAV vector. The AAV vector developed here also offers compatibility with the Gateway cloning technology, a feature that may facilitate the construction of vectors containing varied promoters and/or genes of interest.…”

“…This chimeric promoter was inserted into a recombinant serotype 5 adenoviral vector (termed AdPG) and used to drive expression of the luciferase reporter gene. We observed both specific and high level transgene expression induced by p53 (Bajgelman and Strauss, 2008). Despite the wide use of adenovirus for in vivo applications, data from the literature suggest some drawbacks, such as its immunogenicity and shortterm expression (Alemany et al, 2000;Olive et al, 2002;Worgall et al, 1997).…”

“…The construction of the AAVPG vector began by inserting sequences to direct site-specific homologous recombination in a promoterless AAV2 transfer vector. In parallel, the chimeric promoter responsive to p53, called PGTxβ (Bajgelman and Strauss, 2008), and the gene of interest, luciferase, were inserted in a second plasmid already encoding sequences for site directed recombination that are compatible with the new AAV2 transfer vector. The final vector, AAVPG-luc, was derived by recombination between the two plasmids.…”

“…p53) were (Strauss and Costanzi-Strauss, 2004). Second generation: AdPG is a serotype 5 adenoviral vector which has a chimeric p53-responsive promoter, PGTxβ, driving expression of the transgene (Bajgelman and Strauss, 2008). Third generation: AAVPG is a recombinant serotype 2 adeno-associated virus that contains the PGTxβ promoter driving expression of the transgene.…”

“…excised from pCDNA/V5-DEST (Invitrogen) into pAAVCMV (Stratagene) after removing the CMV promoter/enhancer sequences. To generate the pEntr vector, we used PCR to amplify the expression cassette PGTxβ-luc from pAdPG-luc (Bajgelman and Strauss, 2008), with primers PG-Topo D Forward (5′CACCTCTTTCCCACCCTTAAC-CAC3′) e PG-Topo D Reverse (5′TAGGCTCAAGCAGTGATCCT3′) and inserted this into pEntr-D-topo (Invitrogen). Recombination with pAAV-dest yielded the AAVPG-luc vector.…”