Development of a versatile tool for the simultaneous differential detection of Pseudomonas savastanoi pathovars by End Point and Real-Time PCR

Abstract

BackgroundPseudomonas savastanoi pv. savastanoi is the causal agent of olive knot disease. The strains isolated from oleander and ash belong to the pathovars nerii and fraxini, respectively. When artificially inoculated, pv. savastanoi causes disease also on ash, and pv. nerii attacks also olive and ash. Surprisingly nothing is known yet about their distribution in nature on these hosts and if spontaneous cross-infections occur. On the other hand sanitary certification programs for olive plants, also including P. savastanoi, were launched in many countries. The aim of this work was to develop several PCR-based tools for the rapid, simultaneous, differential and quantitative detection of these P. savastanoi pathovars, in multiplex and in planta.ResultsSpecific PCR primers and probes for the pathovars savastanoi, nerii and fraxini of P. savastanoi were designed to be used in End Point and Real-Time PCR, both with SYBR® Green or TaqMan® chemistries. The specificity of all these assays was 100%, as assessed by testing forty-four P. savastanoi strains, belonging to the three pathovars and having different geographical origins. For comparison strains from the pathovars phaseolicola and glycinea of P. savastanoi and bacterial epiphytes from P. savastanoi host plants were also assayed, and all of them tested always negative. The analytical detection limits were about 5 - 0.5 pg of pure genomic DNA and about 102 genome equivalents per reaction. Similar analytical thresholds were achieved in Multiplex Real-Time PCR experiments, even on artificially inoculated olive plants.ConclusionsHere for the first time a complex of PCR-based assays were developed for the simultaneous discrimination and detection of P. savastanoi pv. savastanoi, pv. nerii and pv. fraxini. These tests were shown to be highly reliable, pathovar-specific, sensitive, rapid and able to quantify these pathogens, both in multiplex reactions and in vivo. Compared with the other methods already available for P. savastanoi, the identification procedures here reported provide a versatile tool both for epidemiological and ecological studies on these pathovars, and for diagnostic procedures monitoring the asymptomatic presence of P. savastanoi on olive and oleander propagation materials.

High-Resolution Melting Analysis as a Powerful Tool to Discriminate and Genotype Pseudomonas savastanoi Pathovars and Strains

“…However, it was never possible to simultaneously discriminate the three pathovars using a single SNP marker. This goal was achieved by developing a multiplex HRM protocol using the primers for the couples of markers C2/L1 or R/L1: for each combination of primer pairs the pathovar identification carried out on the 56 P. savastanoi strains tested here was 100% coherent with the results obtained using the highly specific Real-Time PCR assay previously set up for this bacterium [41]. This test was also shown to be highly reproducible in independent experiments as well as considerably sensitive, since a LLOD of 10 fg or 1 pg of DNA template was obtained for markers C2/L1 and R/L1, respectively.…”

Indole-3-acetic acid in plant–pathogen interactions: a key molecule for in planta bacterial virulence and fitness

“…Antibiotics, when required, were added to the medium at the following concentrations: 20 mg/ml streptomycin, 50 mg/ml nitrofurantoin, 10 mg/ml gentamicin and 50 mg/ml kanamycin. Any bacterial contamination was excluded by periodic monitoring using PCR-based assays specific for P. savastanoi [35,36].…”

“…Photographic records were obtained at 7, 14 and 21 days post-inoculation (dpi). At the same time points, bacterial growth was also estimated as previously described [36,45]. Three independent experiments were performed and nine plants for each P. savastanoi strain were inoculated in each run.…”

Characterization of bacterial knot disease caused by Pseudomonas savastanoi pv. savastanoi on pomegranate (Punica granatum L.) trees: a new host of the pathogen

“…Bacterial knot disease agent Psv is the most important bacterial diseases of olive trees in the Mediterranean countries including Turkey (Tegli et al . ; Mirik and Aysan ). Disease agent has been also detected in Australia, USA, Asia, North Africa and the Middle East (Hall et al .…”

“…Identification of bacterial isolates was performed using the specific polymerase chain reaction (PCR) described by Tegli et al . (). In the PCR assay, primer pair, Psv F (5‐GGCGATGTTCTCAGCGGATTTG‐3) and Psv R (5‐GATCAAGTGTCCAAGGAAGTGAAGG‐3), which was designed from enterobacterial repetitive intergenic consensus (ERIC) sequences, was used and produced a fragment of 388 bp.…”