Development of a simple coarse-grained DNA model for analysis of oligonucleotide complex formation

Wang, Kye Won; Barker, Karolyn; Benner, Steven W.; Betancourt, Tania; Hall, Carol K.

doi:10.1080/08927022.2018.1469753

Cited by 7 publications

(11 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…According to the Watson–Crick base pairing rule, only adenine–thymine and cytosine–guanine interactions need to be taken into account. The interactions between CG nucleotides are represented using the square-well potential; the model parameters were established in our previous research . The interactions between EO and nucleotides are considered as hard sphere for simplicity.…”

Section: Model and Methodsmentioning

confidence: 99%

“…Simulations are performed at body temperature (310 K) because the hydrogel’s drug transport should take place in the body. The unitless simulation body temperature is taken from our previous paper ( T s,body = 0.58) . In our simulations, the temperature is cooled by 0.01 for every 1 million collision from an initial very high temperature of T s = 8.0 until this temperature was achieved.…”

Section: Model and Methodsmentioning

confidence: 99%

“…This paper is the second in a three-part series. The first paper describes the development of a coarse-grained (CG) model for simulation of DNA hybridization . In this, the second paper, we simulate the formation of the DNA-mediated hydrogel using the developed model and assess the hydrogel’s drug loading ability.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Computational Study of DNA-Cross-Linked Hydrogel Formation for Drug Delivery Applications

2018

Self Cite

View full text Add to dashboard Cite

We present the results of discontinuous molecular dynamics (DMD) simulations aimed at understanding the formation of DNA-mediated hydrogels and assessing their drug loading ability. Poly(ethylene glycol) (PEG) precursors of four and six arms that are covalently functionalized on all ends with oligonucleotides are cross-linked by a single oligonucleotide whose sequence is complementary to the oligonucleotide conjugated to the precursor. We show that the precursors with large molecular weight and many arms are advantageous in forming a three-dimensional percolated network. Analysis of the percolated networks shows that the pore diameter distribution becomes narrower as the precursor concentration, the number of arms, and the molecular weight increase. The pore throat diameter, the size of the largest molecule that can travel through the hydrogel networks without being trapped, is determined. The percolated network slows the movement of molecules inside the pores. Molecules larger than the pore throat diameter have more restrictions on their movement in the percolated network than those with smaller sizes.

show abstract

Section: Model and Methodsmentioning

confidence: 99%

Section: Model and Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Computational Study of DNA-Cross-Linked Hydrogel Formation for Drug Delivery Applications

2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…Bahan yang digunakan pada penelitian ini yaitu sekuen 12S rRNA dari DNA mitokondria (mt-DNA) Sus scrofa yang diperoleh dari database National Center for Biotechnology Information (NCBI) (Gambar 1) [25]. Perangkat lunak yang digunakan pada penelitian ini diantaranya terdapat Sistem Operasi Windows 10 yang dilengkapi dengan beberapa server web seperti Integrated DNA Technologies (IDT) [26], MFEprimer-3.1 [27], SnapGene Viewer [28], dan OligoAnalyzer™ Tool [29]. Perangkat keras yang digunakan pada penelitian ini adalah berupa laptop dengan spesifikasi Random Access Memory (RAM) delapan gigabyte (8 GB) Intel® Atom™ Processor Z3735F Quad Core (1.33GHz, 2M Cache) up to 1.83 GHz.…”

Section: Alat Dan Bahanunclassified

“…Pasangan primer forward dan primer reverse dari kandidat primer yang sudah didapatkan dari server web MFEprimer-3.1 kemudian ditentukan sifat-sifatnya menggunakan server web OligoAnalyzer™ Tool melalui situs web https://www.idtdna.com/pages/tools/ oligoanalyzer/ dengan parameter berupa beberapa sifat primer yang meliputi panjang produk, panjang basa nukleotida, persentase G dan C (%GC), titik leleh (Tm), dan sifat sekunder yaitu hairpin, self-dimer, dan heterodimer [29].…”

Section: Penentuan Sifat Kandidat Primer Menggunakanunclassified

Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

2021

View full text Add to dashboard Cite

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.

show abstract

Development of a coarse-grained lipid model, LIME 2.0, for DSPE using multistate iterative Boltzmann inversion and discontinuous molecular dynamics simulations

Wang

Hall

2020

Fluid Phase Equilibria

View full text Add to dashboard Cite

Development of a simple coarse-grained DNA model for analysis of oligonucleotide complex formation

Cited by 7 publications

References 50 publications

Computational Study of DNA-Cross-Linked Hydrogel Formation for Drug Delivery Applications

Computational Study of DNA-Cross-Linked Hydrogel Formation for Drug Delivery Applications

Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

Development of a coarse-grained lipid model, LIME 2.0, for DSPE using multistate iterative Boltzmann inversion and discontinuous molecular dynamics simulations

Contact Info

Product

Resources

About