Development of a qPCR for Leifsonia xyli subsp. xyli and quantification of the effects of heat treatment of sugarcane cuttings on Lxx

Abstract

The main control practice of Leifsonia xyli subsp. xyli (Lxx) in sugarcane is to heat-treat cane 15 cuttings used as planting material in an attempt to eradicate the bacterium. A real time 16 quantitative PCR (qPCR) protocol specific for Lxx was developed to assess the effectiveness of 17 this practice. Primers were designed from the sequence of an Lxx-specific gene and detected as 18 were collected from plant canes with low bacterial titers whereas in the second they were 22 collected from first-ratoon canes with higher titers. Lxx was quantified in leaves by qPCR 90 23 *Manuscript Click here to view linked References 2 days after planting. Lxx was detected at variable titers in 50 to 90% of the plants, indicating that 24 the heat treatment was not effective in eradicating Lxx from all plants. However, in the second 25 experiment the bacterial population was reduced, as the median number of Lxx cells was lower 26 compared to the non-treated control. In the case of SP70-3370, the treatment also reduced the 27 number of Lxx-infected plants considering the pooled data of the two experiments. The results 28 indicated that although the heat treatment did not completely eliminate the bacterium, it can be 29 used to reduce the pathogen population in plants propagated from canes with high bacterial titers. 30

Comparison of Leifsonia xyli subsp. xyli molecular detection in heat-treated sugarcane setts1

“…None of the treatments completely eliminated Lxx from the setts. These outcomes corroborate those of Carvalho et al (2016), who developed a protocol to assess different heat treatment combinations, using quantitative PCR, and also found that the heat treatment only reduced bacterial levels in treated setts. Quantitative PCR also demonstrated that the decrease was greater in setts treated for more than one hour at temperatures of 50 ºC and 52 ºC, if compared to shorter treatments and the control.…”

Activities of key enzymes in the C4 pathway and anatomy of sugarcane infected by Leifsonia xyli subsp . xyli

“…Genomic DNA of the collected samples were extracted according to the instructions of TIANamp Bacteria DNA Kit (Bionicle Genomic DNA Extraction Kit (Tiangen, Beijing, China); DP302). The amplification of a 106‐bp fragment of Lxx DNA was obtained using primer sets of Lxx12950F1/R1 (F1: 5'‐GCACATCGATCTGGAAAAAAGG‐3', and R1, 5'‐GGATTCGGTTCTCATCTCAGC‐3') (Carvalho et al ). Genomic DNA of Lxx was used to prepare the standard curve according to the Ct values obtained after serial dilutions of Lxx DNA.…”

The physiological characteristics and associated gene expression of sugar cane inoculated with Leifsonia xyli subsp. xyli

“…Control measures for ratoon stunt in China include its timely diagnosis in plants, as well as meristem tissue cultures, the sterilization of harvesting and planting equipment, and seedcane heating treatment (Sheng, Chen, Yang, & Deng, ). The last of these treatments, seedcane thermotherapy and equipment disinfection, have only limited efficacy, however, and cannot be used to completely eradicate Lxx (Carvalho et al., ). At the same time, meristem tissue culture consumes both time and resources (Zhang et al., ).…”