Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish

Abstract

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment.

Assessing the population transmission dynamics of tilapia lake virus in farmed tilapia

“…Although the TCID50 values were different in experimental settings of employed literature (Eyngor et al., ; Tattiyapong, Sirikanchana, & Surachetpong, ; Tattiyapong et al., ), Kembou Tsofack et al. () demonstrated that values of TCID50 for E‐11 cell line exposed to TiLV ranged from 1.6 × 10 5 to 4 × 10 6 , consistent with applied doses of 2.6 × 10 5 and 1 × 10 6 TCID50 fish −1 in cohabitation and I.P.…”

Minimal risk of tilapia lake virus transmission via frozen tilapia fillets

“…The viral load from fish fillet was determined using SYBR green‐based RT‐qPCR assay (Tattiyapong et al., ). In brief, 200 ng of cDNA in a 10 μl reaction was performed consisting of 5 μl of 2x iTaq ™ universal SYBR Supermix (Bio‐Rad Laboratories Inc.), 0.3 μl of forward primer (TiLV‐112F: 5′‐CTGAGCTAAAGAGGCAATATGGATT‐3′), and 0.3 μl of reverse primer (TiLV‐112R: 5′‐CGTGCGTACTCGTTCAGTATAAGTTCT‐3′).…”

“…The conditions used were as follows: 1 cycle of 95°C for 3 min, 40 cycles of 95°C for 10 s and 60°C for 30 s. At the end of the reaction, melting curve analysis was performed at 65–95°C with an increment of 0.5°C per 5 s according to Tattiyapong et al. ().…”

“…Subsequently, TiLV was found in many countries including Ecuador (Bacharach et al., ), Colombia (Kembou Tsofack et al., ), Egypt (Fathi et al., ; Nicholson et al., ), Thailand (Dong et al., ; Surachetpong et al., ), India (Behera et al., ), Indonesia (Koesharyani, Gardenia, Widowati, Khumaira, & Rustianti, ), Uganda and Tanzania (Mugimba et al., ), and Malaysia (Amal et al., ). In clinically infected fish, TiLV has been detected in several organs including liver, spleen, anterior kidney, gills, heart as well as muscle (Dong et al., ; Tattiyapong, Dachavichitlead, & Surachetpong, ; Tattiyapong, Sirikanchana, & Surachetpong, ). To date, various methods have been used for the diagnosis of TiLV such as reverse transcription–polymerase chain reaction (RT‐PCR), RT‐quantitative PCR (RT‐qPCR), histopathology and viral isolation in susceptible cells (Behera et al., ; Jaemwimol et al., ; Kembou Tsofack et al., ; Tattiyapong et al., ; Waiyamitra et al., ).…”

“…In clinically infected fish, TiLV has been detected in several organs including liver, spleen, anterior kidney, gills, heart as well as muscle (Dong et al., ; Tattiyapong, Dachavichitlead, & Surachetpong, ; Tattiyapong, Sirikanchana, & Surachetpong, ). To date, various methods have been used for the diagnosis of TiLV such as reverse transcription–polymerase chain reaction (RT‐PCR), RT‐quantitative PCR (RT‐qPCR), histopathology and viral isolation in susceptible cells (Behera et al., ; Jaemwimol et al., ; Kembou Tsofack et al., ; Tattiyapong et al., ; Waiyamitra et al., ).…”