Development and Optimization of Chromosomally-Integrated Fluorescent Mycobacterium tuberculosis Reporter Constructs

Abstract

Mycobacterium tuberculosis resides in the lungs in various lesion types with unique microenvironmental conditions. This diversity is in line with heterogeneous disease progression and divergent drug efficiency. Fluorescent reporter strains can be used to decipher the micromilieu and to guide future treatment regimens. Current reporters using replicating plasmids, however, are not suitable for long-term mouse infections or studies in non-human primates. Using a combination of recombinant DNA and protein optimization techniques, we have developed reporter strains based on integrative plasmids, which exhibit stimulus-response characteristics and fluorescence intensities comparable to those based on replicating plasmids. We successfully applied the concepts by constructing a multi-color reporter strain able to detect simultaneous changes in environmental pH, Mg2+ concentrations, and protein expression levels.

Anti-capsule human monoclonal antibodies protect against hypervirulent and pandrug-resistantKlebsiella pneumoniae

“…Codon-optimized tandem copies of the sfmCherry gene fused to the pTAC promoter were synthesized by GeneArt (Thermo Fisher Scientific) and cloned into the HindIII and SpeI restriction sites of the pSEVA23a1 vector 79 where a hygromycin resistance cassette had been inserted in BamHI and XbaI. Two copies of sfmCherry were employed to maximise expression of the fluorescent protein, according to what had been reported by Kolbe and colleagues 80 . Restriction enzymes were from New England Biolabs.…”

The diversity of clinicalMycobacterium abscessusisolates in morphology, glycopeptidolipids and infection rates in a macrophage model

“…This plasmid contains pMV306 integrase attP as a one-step integration construct. Briefly, the mScarlet or mWasabi coding sequences, placed under the control of the constitutive P left* promoter, were PCR-amplified by Q5® High-Fidelity DNA Polymerase (New England Biolabs) using plasmid L5 attB::Pleft*mScarlet/mWasabi (Addgene plasmids 169410 and 169409, respectively) as DNA templates [15]. Primer pairs, dual forward primer P*: ATCTTTAAATCTAGATGGCCGCGGTACCAGATCTT, mScarlet reverse primer: AGCTGGATCCATGGATTCACTTGTACAGCTCGTCCATGCC, mWasabi reverse primer: AGCTGGATCCATGGATTTACTTGTACAGCTCGTCCATGCC.…”

DNA-Dependent Binding of Nargenicin to DnaE1 Inhibits Replication in Mycobacterium tuberculosis

“…The ATc-regulated CRISPRi system developed by Rock et al 40 was used to construct inducible dnaE1 -targeting Mtb hypomorphs carrying the mScarlet fluorescence reporter. 74 Briefly, two oligonucleotides complementary to the dnaE1-targeting sequence ( Table S3 ) were annealed and cloned in pLJR965, and the presence of the sgRNA was confirmed by Sanger sequencing. The sequence-verified constructs were electroporated into Mtb mScarlet, selecting on media supplemented with Kan (25 μg/mL) and Hyg (50 μg/mL).…”