Development and Application of a RT-NestPCR Assay for Differential Detection of C-Strain and Wild-Type Viruses of Classical Swine Fever Virus

Abstract

Due to the urgent need of differentiation of infected from vaccinated animals in control and eradication of classical swine fever (CSF) and the shortcomings of current differential diagnostic tools, this study is aiming to establish a RT-nestPCR assay for differential detection of wild-type viruses and lapinized Chinese vaccine strain (C-strain) of classical swine fever virus (CSFV) of high sensitivity. Two pairs of CSFV-specific primers were designed in the conservative regions of NS5B (a non-structural protein encoded by the CSFV genome, which performs the RNA dependent RNA polymerase activity) and 3′ un-translated regions (3′-UTR) to encompass the T-rich insertion uniquely existing in the 3′-UTR of C-strain genome. Thus the amplification fragment of C-strain is longer than that of the wild-type viruses for it contains the T-rich insertion region. Two pairs of primers were used in combination and the wild-type viruses and C-strain of CSFV could be detected and accurately distinguished with a high sensitivity through super fine resolution (SFR) argarose gel electrophoresis that displays the different lengths of the amplicons. The detection limit of the C-strain and Shimen strain were respectively 4.5×10 -2 pg and 3.2×10 -2 pg of viral RNA. The results of the specificity test showed that this method can detect different strains of CSFV without amplifying other non-CSFV pathogens. The results of the detection of 400 clinical samples indicated that 16 samples were CSFV positive in total; in which 4 samples were C-Strain positive and 12 were wild-type CSFV positive. The total CSFV positive rate was 4%. The detection results of the 14 batches of C-Strain vaccines showed that all samples displayed bands of C-Strain amplicons in the SFR argarose gel electrophoresis and all vaccines were free of wild-type virus contamination. In conclusion, the RT-nestPCR assay established in the present study could supply a sensitive and specific test method for distinguishing wild-type CSFV infected animals from those vaccinated with C-strain vaccines in the field.

Differentiation of Classical Swine Fever Virus Virulent and Vaccine Strains by CRISPR/Cas13a

“…CSFV nested PCR (nPCR) was performed according to OIE recommend and previous study with some modifications ( 35 ). Primary PCR was performed with outer primer pairs (outer-forward-primer 5′- CAACTGGCTVGTYAAYGC -3′ and outer-reverse-primer 5′- AATGAGTGTAGTGTGGTAAC -3′, V = A or G; Y = C or T) in a 25-μL cocktail, which contained 12.5 μL 2× rTaq mix (TaKaRa, China), 1 μL 10 μmol/L outer forward or reverse primer each, 8 μL double-distilled water, and 2.5 μL 10-fold diluted cDNA.…”

Generation and immunogenicity analysis of recombinant classical swine fever virus glycoprotein E2 and Erns expressed in baculovirus expression system

“…The total RNA was extracted and reverse transcribed. For RT-NestPCR [ 28 ], cDNAs were prepared for first round PCR with outer primer pairs (Outer-F: 5′-CAACTGGCTAGTTAATGCA-3′ and Outer-R: 5′-AATGAGTGTAGTG-…”

Development and Application of a High Sensitivity Immunochromatographic Test Strip for Detecting Classical Swine Fever Virus Antibody

“…In order to evaluate the efficacy of CSF vaccines, develop better immune procedure and eliminate pigs with low immune responses, a practical and rapid test approach is needed for monitoring CSFV antibodies in routine field practice. At present, the indirect fluorescent assay (IFA), immunoperoxidase monolayer assay (IPMA), virus neutralization test (VNT), enzyme-linked immunosorbent assay (EILSA), and the positive indirect hemagglutination assay (IHA) are the commonly used methods to detect CSFV antibodies (9)(10)(11)(12). These methods are all highly sensitive and accurate but still have certain limitations, such as complicated experimental procedure, time-consuming, and necessary expensive equipment and maintenance cost.…”