Detection of swine hepatitis E virus in the porcine hepatic lesion in Jeju Island

Abstract

Swine hepatitis E virus (HEV) is an emerging zoonotic pathogen due to its close genomic similarity to human HEV. The prevalence of swine HEV in the hepatic lesion of pigs from the Jeju Island was investigated by reverse transcriptase polymerase chain reaction (RT-PCR). In total, 40 pigs with hepatitis lesions were selected from 19 different farms, based on examination by microscopy. RT-PCR findings revealed swine HEV in 22 cases (55%), including 18 suckling pigs and 4 growing pigs. Several histopathological lesions, including multifocal lymphoplasmacytic hepatitis, portal inflammation, and focal hepatocellular necrosis, were observed in liver sections of swine HEV PCR-positive pigs. The present study suggests that the prevalence of swine HEV is very high in the pig population in Jeju Island, and that pigs are infected at early stages of growth (under 2 months of age). The high prevalence of swine HEV in pigs in Jeju Island and the ability of this virus to infect across species puts people with swine-associated occupations at possible risk of zoonotic infection.

Hallmarks of liver lesions in pigs naturally infected by hepatitis E virus genotype 3

“…These microscopic lesions were reported before, but did not systematically described in piglets naturally infected by HEV in the United States of America (Meng et al 1997) and South Korea (Lee et al 2007). Moreover, the profile of liver lesions can be related to host response, virus load and infection phase (Meng 2010) as we pointed in the systematic analysis of the hepatic lesions.…”

“…Lobular activity and portal hepatitis have also been previously experimentally demonstrated in the early stages of infection in chimpanzees inoculated with HEV (Yu et al 2010) and; thus, the data of an acute hepatitis pattern seems to be directly related to HEV-RNA detection in the liver of naturally (Lee et al 2007) and experimentally infected pigs (Halbur et al 2001, Schlosser et al 2014.…”

“…Features of hepatic lesions in pigs naturally infected by HEV genotypes 3 and 4 are still little described (Meng et al 1997, Lee et al 2007) although experimental studies in swine using isolates of genotype 3 documented microscopic hepatitis (Halbur et al 2001, Schlosser et al 2014. The aim of this study is to describe the main histopathological liver lesions in naturally HEV genotype 3 infected pigs, which were slaughtered for human consumption in the Eastern Brazilian Amazon, a HEV non-endemic region.…”

Phylogenetic analysis of hepatitis E virus in domestic swine and wild boar in Germany

“…RNA was extracted from 140 ml fecal suspension or serum using the QIAamp Viral RNA Mini Kit TM (Qiagen) according to the manufacturer's instructions. RT-PCR was performed as described previously using primers F1 (AGCTCCTGTACCTGATGTTGACTC), R1 (CTACAGAGCGCCAGCCTTGATTGC), F2 (GCTCACGT-CATCTGTCGCTGCTGG) and R2 (GGGCTGAACCAAAATCCT-GACATC) which amplify fragments of 404 nt and 241 nt, respectively, from the ORF2 region of the HEV genome (Lee et al, 2007).…”

Hepatitis E Virus

“…These results confirmed the apparent asymptomatic nature of HEV infection in pigs, at least at a macroscopic level (Meng et al 1998a;Kasorndorkbua et al 2002;Leblanc et al 2007). The significant increase of hepatic histopathological lesions constantly associated with HEV infection (Meng et al 1998a;Halbur et al 2001;Williams et al 2001;Lee et al 2007;Martin et al 2007) should be investigated in more detail, and possible less evident effects and damage caused by this apparently subclinical infection on the pig productivity and performance (e.g. growth rate, feed intake, nutrients digestion, pig carcass quality, reproductive parameters) should be further studied, especially in intensive rearing system farms.…”