Detection of Opportunistic Infections by Low-density Microarrays

Abstract

In molecular diagnosis of infectious diseases often more than 1 pathogen has to be considered. As a consequence, a series of labor-intensive and time-consuming polymerase chain reaction (PCR) approaches specific for different putative pathogens have to be carried out. To speed up diagnosis, we established a low-density microarray for simultaneous detection of diverse putative pathogens causing a disease such as granulomatous lymphadenitis. Nucleic acids from formalin-fixed, paraffin-embedded tissues of 68 patients with lymphadenitis were used for molecular diagnosis of individual pathogens by either nested single-assay PCR or 1-step multiplex PCR in combination with low-density microarray hybridization. Multiplex PCR amplicons hybridized to glass slides containing probes from Mycobacterium spp., Yersinia spp., Bartonella henselae, Toxoplasma gondii, and other pathogens showed specific and reproducible signals on the array. Our results show that microarray technology combined with multiplex PCR is a promising and time-saving tool in molecular pathology of infectious diseases, allowing sensitive, simultaneous analyses of different pathogens.

Hepatic granulomas: histological and molecular pathological approach to differential diagnosis–a study of 442 cases

“…Primers recognizing the human haemochromatosis (HFE) gene locus were used in a reference PCR as a positive control for DNA quality (F1: ATGGATGCC AAGGAGTTCGAACC, F2: GCCATAATTACCTCCTCAGGCAC, R1: TTCTCAGCT CCTGGCTCTCATC, R2: TCGAACCTAAAGACGTATTGCCC). Primers for B. henselae , M. tuberculosis and M. avium , Y. enterocolitica and Y. pseudotuberculosis , CMV, EBV and T. gondii were described recently (11–13). For Listeria , the following primers were used: F1/F2: CCCGCCTGGTCTAACTGGATTTG, R1: GGATGGAAATTTGGTCGG CGTACA and R2: GTATATCGTGACTTACGAGG.…”

“…Thus, establishing the aetiology necessitates a broad‐based clinical and pathological approach (1). In the case of an infectious aetiology, similar to other organs, special stains and molecular analyses, such as polymerase chain reaction (PCR) and hybridization approaches, can contribute towards identification of the culpable antigen (10, 11).…”

Large scale multiplex PCR improves pathogen detection by DNA microarrays

“…The question of random or selective pathogen DNA amplification prior to DNA microarray detection has been already addressed [16] and applications of multiplex PCR using a small number of primer pairs corresponding to the capture probes on low density microarrays have been published [16,5,6,16-18]. We present here a further development of this approach, by proposing a large scale multiplex PCR adapted to the format of a prototype medium density microarray developed in our laboratory, employing up to 800 specific primer pairs.…”