Detection and quantification of salep with real time PCR utilizing the nr‐ITS2 region

Abstract

BACKGROUND: Salep is a highly valued food product, susceptible to adulteration with less costly additives such as starch. The aim of this study is to develop a real-time polymerase chain reaction (PCR) method for the detection and quantification of authentic salep using primers designed from the nr-ITS2 region. RESULTS: The designed primers were shown to amplify selectively with salep DNA and cloning/sequencing of end-point PCR products obtained with authentic salep (Orchideceae) confirmed amplimers to be copies of the intended target region. Detection of salep DNA using the designed primer set was possible at levels as low as 20 pg. After initial evaluation of the real-time PCR method with binary DNA mixtures of salep and cornflour, quantification of salep was conducted in binary mixtures of potato starch (a more likely adulterant) and salep, showing that quantification within the range 25%-100% could be achieved. The real-time assay was performed using the 18S rDNA region co-amplified as an internal standard and evaluated using the Ct method. The calibration curves obtained as a result of real-time PCR runs showed linearity, with R 2 values above 99%. CONCLUSION: A real-time PCR method using SybreGreen intercalating dye was established for salep detection and quantification based on the specific amplification of salep DNA. Method validation was performed utilizing blind and commercial samples.

MicroRNA-26b-5p alleviates cerebral ischemia-reperfusion injury in rats via inhibiting the N-myc/PTEN axis by downregulating KLF10 expression

“…First, for all test samples and calibration samples, the CT values of target genes were normalized with the CT values of internal reference genes: ΔCT (test) = CT (target, test) − CT (ref, test), ΔCT (calibrator) = CT (target, calibrator) − CT (ref, Calibrator); secondly, normalize the ΔCT value of the test sample with the ΔCT value of the calibration sample: ΔΔCT = ΔCT (test) − ΔCT (calibrator), and finally, calculate the expression level ratio: 2 −ΔΔCT = the ratio of expression amount. 17 The following primers were used: miR-26b-5p (forward 5’–3’: ATCTCAGTCCTGTACAGTAC, reverse 5’-3’: CGT ACA TGC ACA TAC AGT C); KLF10 (forward 5’–3’: ACG GTG CCT CGG GTT GTG; reverse 5’–3’: TCG ACC AAT CAG CGG TAA AGG).…”

“…; secondly, normalize the DCT value of the test sample with the DCT value of the calibration sample: DDCT ¼ DCT (test) À DCT (calibrator), and finally, calculate the expression level ratio: 2 ÀDDCT ¼ the ratio of expression amount. 17 The following primers were used: miR-26b-5p (forward 5'-3': ATCTCAGTCC TGTACAGTAC, reverse 5'-3': CGT ACA TGC ACA TAC AGT C); KLF10 (forward 5'-3': ACG GTG CCT CGG GTT GTG; reverse 5'-3': TCG ACC AAT CAG CGG TAA AGG).…”