Description and genetic characterisation of Pulchrascaris australis n. sp. in the scalloped hammerhead shark, Sphyrna lewini (Griffin & Smith) in Australian waters

Erection ofEuterranovan. gen. andNeoterranovan. gen. (Nematoda, Anisakidae), with the description ofE.dentiduplicatan. sp. and new records of two other anisakid nematodes from sharks off New Caledonia

“…Pulchrascaris has been recognized by subsequent authors (e.g. [10,36]). The remaining nominal species of Terranova (s. l.) were split by Gibson and Colin [14] into five groups distinguished by the width of the labial prolongations or by their host types, with a sixth group containing species inquirendae or incertae sedis.…”

“…labial structures, are not readily visible in these fairly large nematodes under the LM and, consequently, these were either inadequately described or undescribed in the great majority of Terranova species. To date, only a few Terranova-like species from poikilothermic hosts have been studied using the SEM [10,11,29,35,36,42].…”

“…The only adult anisakid nematode so far reported from elasmobranchs in New Caledonian waters is Terranova scoliodontis (Baylis, 1931), found in the tiger shark Galeocerdo cuvier (Péron et Lesueur) (Carcharhinidae) [29]. In the same region, unidentified larvae attributed to Terranova have been reported from different species of teleosts [22,37,38] and, based on sequence data, some of them were later identified as Terranova pectinolabiata Shamsi, Barton et Zhu, 2019 [35] or Pulchrascaris australis Shamsi, Barton et Zhu, 2020 [36].…”

Occurrence and abundance of zoonotic nematodes in snapper Chrysophrys auratus, a popular table fish from Australian and New Zealand waters

“…Another Anisakid nematode morphologically identified in this study was Terranova type II. Terranova types I and II have been previously identified and reported from other marine fish in Australia and New Caledonia ( Hossen et al, 2021 ; Jabbar et al, 2012 ; Shamsi et al, 2018a ; Hossen and Shamsi, 2019 ; Shamsi et al, 2018b ; Shamsi and Suthar, 2016a ) as Pulchrascaris australis and T. pectinolabiata , respectively ( Shamsi et al, 2019a ; Shamsi et al, 2020 ). Although, the morphological and morphometric data of the present specimens either partially or completely matched with previously identified Terranova larval types ( Table 4 ) the molecular data did not match with existing sequences registered in GenBank and revealed 20.70–20.90% nucleotide variability ( Fig.…”

“…A volume of 25 μl PCR reaction was conducted to amplify the whole ITS (ITS–1, 5.8S, and ITS–2) regions of Anisakid nematodes using the primer sets of forward (SS1): 5′–GTTTCCGTAGGTGAACCTGCG–3′ and reverse (NC2): 5′–TTAGTTTCTTTTCCTCCGCT–3′. The cycling condition was followed according to Hossen and Shamsi (2021) ; Shamsi et al (2020) . A similar volume (25 μl) of PCR for the Cucullanid nematodes was conducted to amplify the whole ITS regions using another primer set, which included forward ITS–F: 5′–CCTAACAAGCCTCAACGGGTG–3′ and reverse ITS–R1: 5’–GCATACGAACTGAGAGCAGCG–3′ with the cyclic conditions of initial 95 °C for 2 min, then 95 °C for 30 s, 60 °C for 45 s, 72 °C for 1 min × 40 cycles following extension at 72 °C for 10 min and finally at 4 °C.…”