Decreased expression of keratinocyte growth factor receptor in a subset of human transitional cell bladder carcinomas

Medina, Sixtina Gil Diez de; Chopin, Dominique; Marjou, Ahmed El; Delouvée, Annie; LaRochelle, William J.; Hoznek, Andràs; Abbou, Claude C.; Aaronson, Stuart A.; Thiery, Jean Paul; Radvanyi, François

doi:10.1038/sj.onc.1200830

Cited by 80 publications

(62 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The dotted (or dashed lines) separate the tumours with low level of E-cadherin (or FGFR2b) with the tumours with normal or high levels. These limits were de®ned for FGFR2b in Gil Diez de Medina et al (1997) and for E-cadherin in Popov et al (submitted), and correspond to 30% of the average values found in normal urothelium. These values corresponded to the tercile of the population for FGFR2b and to the quintile of the population for E-cadherin.…”

Section: Resultsmentioning

confidence: 93%

“…Relative expression of Ecadherin mRNA was assessed by semi-quantitative RT ± PCR using TBP as an internal standard. RNA was extracted on a cesium chloride cushion and the amount of E-cadherin mRNA was determined by semi-quantitative RT ± PCR, by comparison with an internal control, an ubiquitous transcription factor TBP (or GAPDH, data not shown) (Radvanyi et al, 1993;Gil Diez de Medina et al, 1997). Twenty two cycles were used for the coampli®cation of E-cadherin and TBP.…”

Section: Resultsmentioning

confidence: 99%

“…Twenty two cycles were used for the coampli®cation of E-cadherin and TBP. The primer sequences of FGFR2b, GAPDH, TBP are as described by Gil Diez de Medina et al (1997), the primer sequences of E-cadherin are: GACCAAGTGACCACCTTAGA and GCAGGAATTTG-CAATCCTGCT (5' to 3' direction). After gel electrophoresis, the PCR-ampli®ed products were quanti®ed with a Molecular Dynamics 300 PhosphorImager (Sunnyvale, CA, USA).…”

Section: Resultsmentioning

confidence: 99%

“…Metastases were removed by lymph node dissection. Normal urothelial specimens (n=5) were taken from normal bladder as described in Gil Diez de Medina et al (1997) Figure 3 Relationship between E-cadherin and FGFR2b mRNA in bladder and colon cell lines. E-cadherin mRNA levels were plotted against FGFR2b mRNA levels.…”

Section: Resultsmentioning

confidence: 99%

“…In order to identify new molecules involved in bladder tumour progression, we have looked for changes in the level of expression of growth factors and their cognate receptors between normal urothelium and bladder carcinomas of di erent stages and grades. We have previously reported that the epithelial-speci®c isoform of the ®broblast growth factor receptor 2b (FGFR2b) was down-regulated in a subset of bladder tumours with poor prognosis (Gil Diez de Medina et al, 1997). Recently, in an experimental model, it has been shown that FGFR2b can reduce tumour growth (Matsubara et al, 1998).…”

mentioning

confidence: 99%

See 4 more Smart Citations

Relationship between E-cadherin and fibroblast growth factor receptor 2b expression in bladder carcinomas

et al. 1999

Self Cite

View full text Add to dashboard Cite

E-cadherin is a cell-cell adhesion molecule expressed predominantly by epithelial cells. Reduction or loss of Ecadherin immunoreactivity has been associated with tumour progression in many epithelial cancers, including bladder carcinomas. The ®broblast growth factor receptor 2b (FGFR2b) recognized speci®cally by FGF7 is expressed only by epithelial cells. Recently, decreased expression of FGFR2b protein and mRNA was found to be associated with tumour progression in bladder carcinomas. The purpose of this investigation was to look for a possible relationship between E-cadherin and FGFR2b expression in bladder carcinomas. As decreased E-cadherin immunoreactivity was found to correlate directly with decreased expression at the mRNA level, the possible relationship between E-cadherin and FGFR2b was investigated at the mRNA level using semi-quantitative RT ± PCR in 92 transitional cell carcinomas (TCCs) and four lymph node metastases. All tumours with low E-cadherin expression had low expression of FGFR2b, whereas tumours with low FGFR2b mRNA could express any level of E-cadherin mRNA. The same observation was equally valid for bladder and colon cancer cell lines suggesting that, besides bladder tumours, this relationship could apply to other carcinomas types. These results suggest that a relationship exists between the transcription of the Ecadherin and FGFR2b genes preventing high expression of FGFR2b where expression of E-cadherin is low. We suggest that reduced expression of FGFR2b in conjunction with decreased expression of E-cadherin may contribute to the aggressive behaviour attributable to high grade TCCs.

show abstract

Section: Resultsmentioning

confidence: 93%

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Relationship between E-cadherin and fibroblast growth factor receptor 2b expression in bladder carcinomas

et al. 1999

Self Cite

View full text Add to dashboard Cite

show abstract

Binding motifs ofCBP2 a potential cell surface target for carcinoma cells

et al. 2000

View full text Add to dashboard Cite

Previously we have shown (Hebert et al. [1999] J. Cell Biochem. 73:248-258) that among many cell lines the CBP2 gene product, Hsp47, eludes its retention receptor, erd2P, resulting in the appearance of Hsp47 on the cell surface associated with the tetraspanin protein CD9. Since Hsp47 possesses a highly restricted binding cleft, random peptide display libraries were used to characterize peptides binding to Hsp47 and then to target this protein on carcinoma cell lines in vitro. Comparison of the clones obtained from panning revealed little specific homology based on sequence alone. To determine whether carcinoma cells expressing Hsp47 could selectively take up the selected bacteriophages, traditional immunofluorescence and confocal microscopy were employed. These studies revealed that phage-displaying Hsp47 binding peptides bound to cell lines expressing Hsp47 and that the peptides were rapidly taken up to a location coincident with Hsp47 staining. These observations were confirmed by cytometric analyses. These data indicate that CBP2 product may provide a molecular target for chemotherapy and/or imaging of malignancies.

show abstract

Attenuation and loss of hormonal modulation of KGF (FGF-7)/KGF receptor expression and mitogenesis during mammary tumor progression

et al. 2000

View full text Add to dashboard Cite

Keratinocyte growth factor (KGF), alone and in synergism with progesterone (P) and prolactin (PRL), is mitogenic for normal mammary epithelium (ME) in vitro. In addition, P can upregulate ME sensitivity to KGF by slowing KGF receptor (KGFR) mRNA turnover in vitro. These hormonal interactions with KGF in vitro raise the possibility that alterations in these interactions can play a role in hormone-dependent mammary tumor growth and progression. The effect of hormones on KGF mitogenesis and the regulation of KGFR expression was examined in pregnancy-dependent (PDT) and ovarian-independent (OIT) mouse mammary tumors. In serum-free, collagen gel cell culture, dose/response (2-20 ng/ml) and time course studies showed that KGF stimulated the proliferation of PDT (not OIT) cells but synergism with P or PRL was not observed. The level of KGFR mRNA in PDT cells was not significantly different from normal ME but in OIT it was reduced more than 90%. P did not affect KGFR mRNA turnover in cultured PDT cells. However, KGFR mRNA was more stable in PDT cells compared to normal ME; after 6 days culture in basal medium, KGFR mRNA levels declined 40% vs. 85% previously shown for normal ME. Determination of KGF mRNA levels in tissues showed that it was lower in PDT compared to normal mammary gland and not detectable in OIT. These data show that in PDT both KGF-stimulated mitogenesis and the regulation of KGFR expression are independent of hormones. OIT has progressed to independence from any KGF influence. Thus, a subset of hormonally regulated pathways related to epithelial/stromal cell interactions can be lost in hormone-dependent mammary tumors during tumor progression.

show abstract

Decreased expression of keratinocyte growth factor receptor in a subset of human transitional cell bladder carcinomas

Cited by 80 publications

References 34 publications

Relationship between E-cadherin and fibroblast growth factor receptor 2b expression in bladder carcinomas

Relationship between E-cadherin and fibroblast growth factor receptor 2b expression in bladder carcinomas

Binding motifs ofCBP2 a potential cell surface target for carcinoma cells

Attenuation and loss of hormonal modulation of KGF (FGF-7)/KGF receptor expression and mitogenesis during mammary tumor progression

Contact Info

Product

Resources

About