Decreased bone marrow stromal cells activity involves in unilateral anterior crossbite-induced early subchondral bone loss of temporomandibular joints

Yang, Ting; Zhang, Jing; Cao, Yongji; Zhang, Mian; Lei, Jing; Jiao, Kai; Yu, Shuxun; Wang, Meiqing

doi:10.1016/j.archoralbio.2014.05.024

Cited by 17 publications

(19 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…At 2 wk, the osteoclast and osteoblast numbers were decreased in UAC-treated TMJ subchondral trabecular bone (Yang et al 2014) without Wnt5a and Ror2 mRNA changes (data not shown). However, at 4 and 8 wk (Figs.…”

Section: Discussionmentioning

confidence: 70%

Wnt5a/Ror2 Mediates Temporomandibular Joint Subchondral Bone Remodeling

et al. 2015

View full text Add to dashboard Cite

Increased subchondral trabecular bone turnover due to imbalanced bone-resorbing and bone-forming activities is a hallmark of osteoarthritis (OA). Wnt5a/Ror2 signaling, which can derive from bone marrow stromal cells (BMSCs), takes a role in modulating osteoblast and osteoclast formation. We showed previously that experimentally unilateral anterior crossbites (UACs) elicited OA-like lesions in mice temporomandibular joints (TMJs), displaying as subchondral trabecular bone loss. Herein, we tested the role of BMSC-derived Wnt5a/Ror2 signaling in regulating osteoclast precursor migration and differentiation in this process. The data confirmed the decreased bone mass, increased tartrate-resistant acid phosphatase (TRAP)-positive cell number, and enhanced osteoclast activity in TMJ subchondral trabecular bone of UAC-treated rats. Interestingly, the osteoblast activity in the tissue of TMJ subchondral trabecular bone of these UAC-treated rats was also enhanced, displaying as upregulated expressions of osteoblast markers and increased proliferation, migration, and differentiation capabilities of the locally isolated BMSCs. These BMSCs showed an increased CXCL12 protein expression level and upregulated messenger RNA expressions of Rankl, Wnt5a, and Ror2. Ex vivo data showed that their capacities of inducing migration and differentiation of osteoclast precursors were enhanced, and these enhanced capabilities were restrained after blocking their Ror2 signaling using small interfering RNA (siRNA) assays. Reducing Ror2 expression in the BMSC cell line by siRNA or blocking the downstream signalings with specific inhibitors also demonstrated a suppression of the capacity of the BMSC cell line to promote Wnt5a-dependent migration (including SP600125 and cyclosporine A) and differentiation (cyclosporine A only) of osteoclast precursors. These findings support the idea that Wnt5a/Ror2 signaling in TMJ subchondral BMSCs enhanced by UAC promoted BMSCs to increase Cxcl12 and Rankl expression, in which JNK and/or Ca(2+)/NFAT pathways were involved and therefore were engaged in enhancing the migration and differentiation of osteoclast precursors, leading to increased osteoclast activity and an overall TMJ subchondral trabecular bone loss in the UAC-treated rats.

show abstract

Section: Discussionmentioning

confidence: 70%

Wnt5a/Ror2 Mediates Temporomandibular Joint Subchondral Bone Remodeling

et al. 2015

View full text Add to dashboard Cite

show abstract

“…UAC was created as we previously described (Jiao et al, ; Wang et al, ; Yang et al, ; Yang, Zhang, et al, ; Zhang et al, ). Briefly, a straight metal tube (ShinvaAnde) and a curved metal tube (ShinvaAnde) with an angle of 135° to the labial side at the upper end were bonded with zinc phosphate cement (Shanghai Dental Instrument Factory) to the left maxillary and mandibular incisor, respectively, to create an experimental crossbite relationship between the left side incisors.…”

Section: Methodsmentioning

confidence: 99%

“…The blood samples from the rats and patients were stored in ethylenediaminetetraacetic acid (EDTA) centrifuge tubes. The PBLs were collected and separated from the whole blood by kits (WBC107705 (for human blood) and WBC1083 (for rat blood), TBDscience) under the manufacturer's instructions and were then lysed in TRIpure reagent (Roche) at −80°C for qPCR detection, as previously reported (Jiao et al, ; Lu et al, ; Yang et al, ; Yang, Zhang, et al, ; Zhang et al, ). The primers for Egr1 used for the patients were 5′‐GCCAAGCAAACCAATGGTGA‐3′ (forward) and 5′‐GCTCTGAGAATACTGGGACTGCTG‐3′ (reverse), and those for Gapdh (housekeeping gene) were 5′‐GCACCGTCAAGGCTGAGAAC‐3′ (forward) and 5′‐TGGTGAAGACGCCAGTGGA‐3′ (reverse).…”

Section: Methodsmentioning

confidence: 99%

“…Recently, we developed a TMJ OA rodent model by installing an aberrant prosthesis to create a unilateral anterior crossbite (UAC) condition. The induced TMJ OA changes included cartilage degradation, subchondral bone loss as revealed by micro‐CT and altered expression levels of molecular markers (Jiao et al, ; Lu et al, ; Wang et al, ; Yang et al, ; Yang, Zhang, et al, ; Zhang et al, , ). Our recent work indicated that the mRNA expression of Egr1 in peripheral blood leucocytes (PBLs) was increased after 20 weeks of UAC stimulation (Zhang et al, ) at which stage condyle was deformed (Zhang et al, ).…”

Section: Introductionmentioning

confidence: 99%

“…Here we measured the mRNA expression of Egr1 in young TMJ OA patients and verified the changes in UAC rats at an early stage. Osterix (OSX), a marker of early differentiation stage osteoblasts, and dentin matrix protein‐1 (DMP‐1), a marker of late differentiation stage osteoblasts (Lu et al, ; Yang et al, ; Yang, Zhang, et al, ), were detected in UAC rat TMJ samples. The purpose of the study was to “fingerprint” the potential OA‐indicative role of Egr1 expression in PBLs of young adults.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Early growth response 1 reduction in peripheral blood involving condylar subchondral bone loss

et al. 2019

Self Cite

View full text Add to dashboard Cite

Objectives To detect whether early growth response 1 (EGR1) in peripheral blood leucocytes (PBLs) indicates temporomandibular joint (TMJ) osteoarthritis (OA) lesions. Materials and Methods Egr1 mRNA expression levels in PBLs were detected in eight malocclusion patients without temporomandibular disorder (TMD) signs and 16 malocclusion patients with clinical TMD signs with (eight) or without (eight) imaging signs of TMJ OA. Twelve 6‐week‐old rats were randomized to a control group and a unilateral anterior crossbite (UAC) group and were sampled at 4 weeks. The Egr1 mRNA expression levels in PBLs and protein expression levels in different orofacial tissues were measured. Results Patients with TMD signs with/without TMJ OA diagnosis showed lower Egr1 mRNA expression levels in PBLs than patients without TMD signs. The lower Egr1 mRNA expression was also found in the PBLs of UAC rats, which were induced to exhibit early histo‐morphological signs of TMJ OA lesions. In subchondral bone of UAC rats, EGR1 protein expression was decreased, co‐localization of EGR1 with osterix or dentin matrix protein‐1 was identified, and the number of EGR1 and osterix double‐positive cells was reduced (all p < .05). Conclusion Egr1 reduction in PBLs potentially indicates subchondral bone OA lesions at an early stage.

show abstract

Effect of asymmetric force on the condylar cartilage, subchondral bone and collagens in the temporomandibular joints

Zhang

Cheng

et al. 2015

Archives of Oral Biology

View full text Add to dashboard Cite

Decreased bone marrow stromal cells activity involves in unilateral anterior crossbite-induced early subchondral bone loss of temporomandibular joints

Cited by 17 publications

References 19 publications

Wnt5a/Ror2 Mediates Temporomandibular Joint Subchondral Bone Remodeling

Wnt5a/Ror2 Mediates Temporomandibular Joint Subchondral Bone Remodeling

Early growth response 1 reduction in peripheral blood involving condylar subchondral bone loss

Effect of asymmetric force on the condylar cartilage, subchondral bone and collagens in the temporomandibular joints

Contact Info

Product

Resources

About