Data on Some Species of the Genus Coslenchus Siddiqi, 1978 (Rhabditida, Tylenchidae) from Iran

Abstract

Data on five known species of the genus Coslenchus are provided. Morphological and morphometric data are given for all studied species. Three of the recovered species were also characterized by molecular phylogenetic data. The species C. leiocephalus was studied for the first time since its original description. Males of the species, C. franklinae and C. oligogyrus were described for the first time and the species C. oligogyrus was reported from Iran for the first time. In molecular phylogenetic studies based on partial sequences of 28S rDNA D2/D3 fragments, all species formed a clade with high Bayesian posterior probability in Bayesian inference, indicating the monophyly of the genus. The clade of Coslenchus spp. formed a highly supported monophyletic group, a sister clade to two species of the genus Aglenchus.

First Report of Three Tylenchidae Taxa from Southern Alberta, Canada

“…Andrássy [23] did a thorough review of Coslenchus and concluded that the genus is homogenous. This close morphological affinity is also reflected in several phylogenetic studies [7,36,81] where all the Coslenchus species form a monophyletic clade. Our results are also in line with these studies, i.e., the Canadian population of C. acceptus was nested within the Coslenchus clade with very little sequence divergence.…”

“…The family Tylenchidae is notorious for its complicated taxonomy and morphology, whereby phenotypic convergence of morphologically similar but genetically distant genera cause problems in the delimitation of taxa [6,35]. However, implementation of molecular tools allows nematologists to better study the characters and utilize them to distinguish the species [6,7,11,34,35,79]. In our phylogenetic analysis, B. bhabi exhibited a sister relationship with B. ritteri and clustered distant from the other species of Basiria.…”

“…Nematodes in the cp-2 category have ecological relevance as soil health indicators [5]. The taxonomic placement of Tylenchidae in terms of feeding behavior is controversial [6,7], since the feeding habits and food preferences of the majority of tylenchid genera are unknown. Thus, members of this family are either regarded as root hair/epidermal feeders [3], fungivores [8], or herbivores [9], or are generally referred to as plant associates [10].…”

Occurrence of Neodolichodorus persiangulfus n. sp. (Nematoda: Dolichodoridae) in mangrove forests of southern Iran

“…DNA samples were stored at −20°C until used as polymerase chain reaction (PCR) templates. PCR and sequencing were performed as described by Panahandeh, Pourjam, and Pedram (2016). The D2-D3 domains of the LSU rDNA were amplified using forward primer D2A (5ʹACAAGTACCGTGAGGGAAAGT 3ʹ) and reverse primer D3B (5ʹ TGCGAAGGAACCAGCTACTA 3ʹ) (Nunn, 1992).…”

“…For amplification of SSU rDNA, the forward primer 1096F (5ʹ GGTAATTCTGGAGCTA ATAC 3ʹ) and reverse primer 1912R (5ʹ TTTACGGTCAG AACTAGGG 3ʹ); forward primer 1813F (5ʹ CTGCGTGA GAGGTGAAAT 3ʹ) and reverse primer 2646R (5ʹ GCTACCTTGTTACGACTTTT 3ʹ) (Holterman et al, 2016); and forward primer F22 (5ʹ TCCAAGGAAGGCAGCAGGC 3ʹ) and reverse primer 1573R (5ʹ TACAAAGGGCAGGGACGTAAT 3ʹ) were used. PCR and sequencing were performed as described by Panahandeh, Pourjam, and Pedram (2016). The PCR amplicon sizes were verified in a 1.2% agarose gel and visualized by staining with Green Viewer ™ (0.05 μl/ ml).…”