Cytotoxic Mycoepoxydiene Derivatives from an Endophytic Fungus <i>Phomopsis</i> sp. Isolated from <i>Hydnocarpus anthelminthicus</i>

Prachya, Surasak; Wiyakrutta, Suthep; Sriubolmas, Nongluksna; Ngamrojanavanich, Nattaya; Mahidol, Chulabhorn; Ruchirawat, Somsak; Kittakoop, Prasat

doi:10.1055/s-2007-990240

Cited by 42 publications

(31 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) [24] were used to amplify the ITS1-5.8S-ITS2 region from the extracted DNA, and the PCR product was subjected to DNA sequencing as previously described. [25] A BLAST 2.2.22 + search [26] through the GenBank database for DNA sequence similarity suggested that the CTOM11 strain is a fungus in the genus Curvularia. However, the ITS1-5.8S-ITS2 sequences of reference fungal type strains were not available in the GenBank database, which made reliable species assignment for the CTOM11 strain not possible by this method.…”

mentioning

confidence: 99%

Curvularides A–E: Antifungal Hybrid Peptide–Polyketides from the Endophytic Fungus Curvularia geniculata

Chomcheon

Wiyakrutta

Aree

et al. 2010

Chemistry A European J

Self Cite

View full text Add to dashboard Cite

Five new hybrid peptide-polyketides, curvularides A-E (1-5), were isolated from the endophytic fungus Curvularia geniculata, which was obtained from the limbs of Catunaregam tomentosa. Structure elucidation for curvularides A-E (1-5) was accomplished by analysis of spectroscopic data, as well as by single-crystal X-ray crystallography. Curvularide B (2) exhibited antifungal activity against Candida albicans, and it also showed synergistic activity with a fluconazole drug.

show abstract

mentioning

confidence: 99%

Curvularides A–E: Antifungal Hybrid Peptide–Polyketides from the Endophytic Fungus Curvularia geniculata

Chomcheon

Wiyakrutta

Aree

et al. 2010

Chemistry A European J

Self Cite

View full text Add to dashboard Cite

show abstract

“…Phomopsis, Penicillium and Xylaria were the fungal genera that presented the highest antibacterial activity. Fungi of these genera are well known in the literature for their biological activities and several studies prove their potential as producers of biologically active secondary metabolites (Kobayashi et al, 2003;Prachya et al, 2007;Rukachaisirikul et al, 2008).…”

Section: Discussionmentioning

confidence: 99%

Antibacterial activity of endophytic fungi isolated from Croton lechleri (Euphorbiaceae)

Vargas¹,

Albuquerque²,

Ribeiro³

et al. 2018

J. Med. Plants Res.

View full text Add to dashboard Cite

Croton lechleri is a native species from the Amazon and used with relative frequency in folk medicine in Brazil and other countries. Diversity and antibacterial activity of endophytic fungi associated with this plant were studied here. Samples of leaves and stems were used and 575 endophytic fungi were isolated (307 from leaves and 268 from stems), comprising 284 morphotypes distributed in 13 genera and unknown. The most frequently isolated genera were Phomopsis (30.78%), Penicillium (21.57%) and Pestalotiopsis (16.70%). Diversity and richness of species were higher in leaf tissues. Fifty-five fungi presented antibacterial activity. The fungi with the highest activity were Phomopsis (6.34%), Penicillium (3.17%), and those unknown (5.28%). Penicillium sp. 9 showed the highest antibacterial activity against Enterococcus faecalis and Phomopsis sp. 8 and Phomopsis sp. 9 against Streptococcus pneumoniae and Staphylococcus aureus. Curvularia sp. 1 and a fungus that could not be identified (Unknown sp. 9), showed the highest antibacterial activity against Klebsiella pneumoniae and Escherichia coli, respectively. Only two fungi (Penicillium sp. 9 and Curvularia sp. 1) inhibited the five tested bacteria. Endophytic fungi of C. lechleri harbor a great diversity of endophytic fungi, which have the potential for producing antibacterial compounds.

show abstract

“…Hant25 was obtained from our previous study [9]. Inoculum was prepared by growing Hant25 on potato dextrose agar (PDA) plates at 25°C for 7 days.…”

Section: Microorganism and Inoculum Preparationmentioning

confidence: 99%

“…With Phomopsis sp. Hant25, no mycoepoxydiene was detectable in malt Czapek broth shake-Xask culture but 26 mg l ¡1 was obtained from static culture [9] where the fungus grew at the medium surface. We hypothesized that surface culture enhances mycoepoxydiene production in the Hant25 fungus.…”

Section: Introductionmentioning

confidence: 99%

“…Hant25 from a Thai medicinal plant, Hydnocarpus anthelminthicus. Mycoepoxydiene together with two derivatives, deacetylmycoepoxydiene and 2,3-dihydromycoepoxydiene could be puriWed from fermentation broth of the Hant25 fungus [9]. Mycoepoxydiene and the deacetyl derivative exhibited potent cytotoxic activities toward HepG2 and KB cells and a wider variety of cancer cell lines, including those from human lung carcinoma (A549), human hepatocellular carcinoma (HCC-S102), human cholangiocarcinoma (HuCCA-1), cervical adenocarcinoma (HeLa), human breast cancer (MDA-MB231), human mammary adenocarcinoma (T47D), human promyelocytic leukemia (HL-60) and murine leukemia (P388).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Optimization of culture conditions for mycoepoxydiene production by Phomopsis sp. Hant25

Thammajaruk

Sriubolmas

Israngkul

et al. 2010

J Ind Microbiol Biotechnol

Self Cite

View full text Add to dashboard Cite

Culture media and fermentation conditions for cultivation of an endophytic fungus Phomopsis sp. Hant25 were investigated in order to improve the yield of mycoepoxydiene, a novel fungal metabolite having potent cytotoxic activity against many cancer cell lines. Mycoepoxydiene accumulated in the culture broth during the stationary phase of fungal growth. Modified M1D medium was superior to malt Czapek, and Czapek yeast autolysate broths in supporting mycoepoxydiene production. Pellet growth was the morphological form that favored biosynthesis of mycoepoxydiene. This could be achieved by incubating the culture statically for 6 days before shaking at 120 rpm. Incorporation of a cellulose paper disc into the culture flask promoted fungal growth at the liquid surface, which accelerated mycoepoxydiene production and maximized the final yield to a level of 354 mg l⁻¹, though fungal attachment to the solid support was not required. Since the peak concentration of mycoepoxydiene in the culture broth was followed by a steeply declining phase, the harvest time had to be precisely determined for maximum product yield. Understanding the factor(s) involved in rapid degradation of mycoepoxydiene could lead to improved final yields.

show abstract

Cytotoxic Mycoepoxydiene Derivatives from an Endophytic Fungus Phomopsis sp. Isolated from Hydnocarpus anthelminthicus

Cited by 42 publications

References 8 publications

Curvularides A–E: Antifungal Hybrid Peptide–Polyketides from the Endophytic Fungus Curvularia geniculata

Curvularides A–E: Antifungal Hybrid Peptide–Polyketides from the Endophytic Fungus Curvularia geniculata

Antibacterial activity of endophytic fungi isolated from Croton lechleri (Euphorbiaceae)

Optimization of culture conditions for mycoepoxydiene production by Phomopsis sp. Hant25

Contact Info

Product

Resources

About