Crystal Structure of the Human Ribosome in Complex with DENR-MCT-1

Lomakin, Ivan B.; Stolboushkina, Elena; Vaidya, Anand T.; Zhao, Chenguang; Garber, Maria; Dmitriev, Sergey E.; Steitz, Thomas A.

doi:10.1016/j.celrep.2017.06.025

Cited by 50 publications

(76 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2D, E). This outcome is in line with structural data that places the DENR-MCTS1 complex in proximity to the mRNA channel within the small ribosomal subunit and that identifies helix 24 as a potential interface of MCTS1 with 18S rRNA (32,33). Moreover, helix 26 has previously been reported to make contacts with sequences upstream of restarting AUG codons on viral RNAs (34).…”

Section: Redistribution Of Ribosomes From Cds To 5' Utrs Upon Denr Knsupporting

confidence: 84%

Charting DENR-dependent translation reinitiation uncovers predictive uORF features and links to circadian timekeeping via Clock

Castelo-Szekely

Matos

Gatfield

2018

Preprint

View full text Add to dashboard Cite

The non-canonical initiation factor DENR promotes translation reinitiation on mRNAs harbouring upstream open reading frames (uORFs). Moreover, DENR depletion shortens circadian period in mouse fibroblasts, suggesting involvement of uORF usage and reinitiation in clock regulation. To identify DENR-regulated translation events transcriptome-wide and, in particular, specific core clock transcripts affected by this mechanism, we have used ribosome profiling in DENR-deficient NIH3T3 cells. We uncovered 240 transcripts with altered translation rate, and used linear regression analysis to extract 5' UTR features predictive of DENR dependence. Among core clock genes, we identified Clock as a DENR target. Using Clock 5' UTR mutants, we mapped the specific uORF through which DENR acts to regulate CLOCK protein biosynthesis. Notably, these experiments revealed an alternative downstream start codon, likely representing the bona fide CLOCK N-terminus. Our findings provide insights into uORF-mediated translational regulation that can regulate the mammalian circadian clock and gene expression at large. regression analysis to characterise 5' UTR features associated with DENR-dependent translational regulation and validate targets identified from our translatome-wide approaches. Finally, we show that DENR regulates efficient CLOCK biosynthesis involving a strong uORF and a so-far unannotated CDS initiation codon. MATERIALS AND METHODSCell culture.NIH3T3 and HEK293FT cells were cultured under standard conditions (DMEM; 10% FCS, 1% penicillin/streptomycin, all from Invitrogen; 37 o C; 5% CO 2 ). Lentiviral particle production in HEK293FT cells using envelope pMD2.G and packaging psPAX2 plasmids, and viral transduction of NIH3T3 cells, were performed following published protocols (10), with puromycin selection at 5 µg/ml for 4 days. Cloning and plasmids.For the generation of lentiviral shRNA expression vectors, two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)): shRNA1: GTACCACAGAAGGTCACGATA, corresponding to clone TRCN0000308443 of the TRC shRNA Library from the Broad Institute; and shRNA2: GTGCCAAGTTAGATGCGGATT, corresponding to clone TRCN0000098826. pLKO.1puro constructs containing Gfp, and Scramble (Addgene no. 1864) shRNAs served as controls.For the generation of dual luciferase (Firefly/Renilla) reporter plasmids, fragments containing the 5' UTR and first 5-14 codons of the selected DENR targets/controls were amplified by PCR from genomic DNA or cDNA, cloned into the BamHI site of the prLV1 dual luciferase reporter plasmid (12), and validated by sequencing. The following primers were used for PCR: Etaa1, forward (for): aaaggatccGACTTGCAA AGATGGCGCTGCAC, reverse (rev): tttggatccactagtGTCCT TCAGCTGCATTCACATTT; Map2k5, for: aaaggatccGGTT CCGGAGTAACAGCGGTCTAAC, rev: tttggatccactagtGGC CAGCCACAGCATTACAGGTTAA; Lrrc28, for: aaaggatcc GCCGCTGAGTGCCGGTCAGCGGGC, rev: tttggatccactag tGATTTCGGATGCCATGACTGAACA; Klhdc8a, for: aaag gatccGTCTCCGACCCTGTAGACACTGCAG, rev: tttggatc cactagtA...

show abstract

Section: Redistribution Of Ribosomes From Cds To 5' Utrs Upon Denr Knsupporting

confidence: 84%

Charting DENR-dependent translation reinitiation uncovers predictive uORF features and links to circadian timekeeping via Clock

Castelo-Szekely

Matos

Gatfield

2018

Preprint

View full text Add to dashboard Cite

show abstract

“…The 16S rRNA is subject to many structural constraints and is therefore used as a benchmark for the method's ability to predict coevolution. Using this dataset, pairs of sites predicted as coevolving can be assessed by comparing them to the known 3D structure of the small ribosomal subunit for several species [E. coli (24), Drosophila melanogaster (25) and Homo sapiens (26)]. Coincidentally, since 16S is shared by all prokaryotes and eukaryotes and is a slowevolving gene, it is also often used to infer phylogenetic relationships, especially focusing on the earliest nodes in the tree of life (16,17).…”

Section: Resultsmentioning

confidence: 99%

“…This threshold is consistent with the one used in ref. 18 (8Å) and is representative of the average resolution of the Protein Data Bank (PDB) structure considered (24)(25)(26). The results obtained with this threshold are robust when considering other possible values in the range of 4Å to 8Å (SI Appendix, Fig.…”

Section: Proximity Of Nucleotides On the 3d Structure Of The 16s Rrnamentioning

confidence: 94%

Simultaneous Bayesian inference of phylogeny and molecular coevolution

Meyer

Dib

Silvestro

et al. 2019

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…Structures of the eIF2D-and MCT-1-DENR-containing ICs show that these re-initiation factors use several functional domains to position initiator tRNA in the Psite of the 40S subunit (Lomakin et al 2017;Weisser et al 2017). One of the domains binds to the 40S eIF1-binding site at the top of helix 44 (Fig.…”

Section: Alternative Translation Initiation Strategiesmentioning

confidence: 99%

Extensions, Extra Factors, and Extreme Complexity: Ribosomal Structures Provide Insights into Eukaryotic Translation

Weisser

Ban

2019

Cold Spring Harb Perspect Biol

View full text Add to dashboard Cite

Although the basic aspects of protein synthesis are preserved in all kingdoms of life, there are many important structural and functional differences between bacterial and the more complex eukaryotic ribosomes. High-resolution cryo-electron microscopy (cryo-EM) and X-ray crystallography structures of eukaryotic ribosomes have revealed the complex architectures of eukaryotic ribosomes and species-specific variations in protein and ribosomal RNA (rRNA) extensions. They also enabled structural studies of a range of eukaryotic ribosomal complexes involved in translation initiation, elongation, and termination, revealing unique mechanistic features of the eukaryotic translation process, especially with respect to the identification and recognition of translation start and stop codons on messenger RNAs (mRNAs). Most recently, structural biology has provided insights into the eukaryotic ribosomal biogenesis pathway by visualizing several of its complex intermediates. This review highlights the past decade's structural work on eukaryotic ribosomes and its implications on our understanding of eukaryotic translation. Outline 1 Ribosomal architecture 2 Eukaryotic ribosomes-Extensions and expansions 3 The eukaryotic translation cycle 4 Eukaryotic translation initiation and reinitiation 5 Alternative translation initiation strategies 6 Eukaryotic translation elongation mechanisms 7 Eukaryotic translation termination and recycling 8 Eukaryotic ribosomal biogenesis 9 Future challenges References

show abstract

Crystal Structure of the Human Ribosome in Complex with DENR-MCT-1

Cited by 50 publications

References 44 publications

Charting DENR-dependent translation reinitiation uncovers predictive uORF features and links to circadian timekeeping via Clock

Charting DENR-dependent translation reinitiation uncovers predictive uORF features and links to circadian timekeeping via Clock

Simultaneous Bayesian inference of phylogeny and molecular coevolution

Extensions, Extra Factors, and Extreme Complexity: Ribosomal Structures Provide Insights into Eukaryotic Translation

Contact Info

Product

Resources

About