Mammalian gene expression displays widespread circadian oscillations. Rhythmic transcription underlies the core clock mechanism, but it cannot explain numerous observations made at the level of protein rhythmicity. We have used ribosome profiling in mouse liver to measure the translation of mRNAs into protein around the clock and at high temporal and nucleotide resolution. We discovered, transcriptome-wide, extensive rhythms in ribosome occupancy and identified a core set of approximately 150 mRNAs subject to particularly robust daily changes in translation efficiency. Cycling proteins produced from nonoscillating transcripts revealed thus-far-unknown rhythmic regulation associated with specific pathways (notably in iron metabolism, through the rhythmic translation of transcripts containing iron responsive elements), and indicated feedback to the rhythmic transcriptome through novel rhythmic transcription factors. Moreover, estimates of relative levels of core clock protein biosynthesis that we deduced from the data explained known features of the circadian clock better than did mRNA expression alone. Finally, we identified uORF translation as a novel regulatory mechanism within the clock circuitry. Consistent with the occurrence of translated uORFs in several core clock transcripts, loss-of-function of Denr, a known regulator of reinitiation after uORF usage and of ribosome recycling, led to circadian period shortening in cells. In summary, our data offer a framework for understanding the dynamics of translational regulation, circadian gene expression, and metabolic control in a solid mammalian organ.
Highlights d Global profiling of mRNA decay pathways and aberrant translation events in mESCs d XRN1 mediates mRNA turnover, whereas SKIV2L acts widely in translation surveillance d AVEN interacts with ribosomes and the Ski complex and counteracts ribosome stalling d Histone mRNAs, uORFs, and small ORFs are key targets of SKIV2L and AVEN
BackgroundThe daily gene expression oscillations that underlie mammalian circadian rhythms show striking differences between tissues and involve post-transcriptional regulation. Both aspects remain poorly understood. We have used ribosome profiling to explore the contribution of translation efficiency to temporal gene expression in kidney and contrasted our findings with liver data available from the same mice.ResultsRhythmic translation of constantly abundant messenger RNAs (mRNAs) affects largely non-overlapping transcript sets with distinct phase clustering in the two organs. Moreover, tissue differences in translation efficiency modulate the timing and amount of protein biosynthesis from rhythmic mRNAs, consistent with organ specificity in clock output gene repertoires and rhythmicity parameters. Our comprehensive datasets provided insights into translational control beyond temporal regulation. Between tissues, many transcripts show differences in translation efficiency, which are, however, of markedly smaller scale than mRNA abundance differences. Tissue-specific changes in translation efficiency are associated with specific transcript features and, intriguingly, globally counteracted and compensated transcript abundance variations, leading to higher similarity at the level of protein biosynthesis between both tissues.ConclusionsWe show that tissue specificity in rhythmic gene expression extends to the translatome and contributes to define the identities, the phases and the expression levels of rhythmic protein biosynthesis. Moreover, translational compensation of transcript abundance divergence leads to overall higher similarity at the level of protein production across organs. The unique resources provided through our study will serve to address fundamental questions of post-transcriptional control and differential gene expression in vivo.Electronic supplementary materialThe online version of this article (doi:10.1186/s13059-017-1222-2) contains supplementary material, which is available to authorized users.
The non-canonical initiation factor DENR promotes translation reinitiation on mRNAs harbouring upstream open reading frames (uORFs). Moreover, DENR depletion shortens circadian period in mouse fibroblasts, suggesting involvement of uORF usage and reinitiation in clock regulation. To identify DENR-regulated translation events transcriptome-wide and, in particular, specific core clock transcripts affected by this mechanism, we have used ribosome profiling in DENR-deficient NIH3T3 cells. We uncovered 240 transcripts with altered translation rate, and used linear regression analysis to extract 5′ UTR features predictive of DENR dependence. Among core clock genes, we identified Clock as a DENR target. Using Clock 5′ UTR mutants, we mapped the specific uORF through which DENR acts to regulate CLOCK protein biosynthesis. Notably, these experiments revealed an alternative downstream start codon, likely representing the bona fide CLOCK N-terminus. Our findings provide insights into uORF-mediated translational regulation that can regulate the mammalian circadian clock and gene expression at large.
The non-canonical initiation factor DENR promotes translation reinitiation on mRNAs harbouring upstream open reading frames (uORFs). Moreover, DENR depletion shortens circadian period in mouse fibroblasts, suggesting involvement of uORF usage and reinitiation in clock regulation. To identify DENR-regulated translation events transcriptome-wide and, in particular, specific core clock transcripts affected by this mechanism, we have used ribosome profiling in DENR-deficient NIH3T3 cells. We uncovered 240 transcripts with altered translation rate, and used linear regression analysis to extract 5' UTR features predictive of DENR dependence. Among core clock genes, we identified Clock as a DENR target. Using Clock 5' UTR mutants, we mapped the specific uORF through which DENR acts to regulate CLOCK protein biosynthesis. Notably, these experiments revealed an alternative downstream start codon, likely representing the bona fide CLOCK N-terminus. Our findings provide insights into uORF-mediated translational regulation that can regulate the mammalian circadian clock and gene expression at large. regression analysis to characterise 5' UTR features associated with DENR-dependent translational regulation and validate targets identified from our translatome-wide approaches. Finally, we show that DENR regulates efficient CLOCK biosynthesis involving a strong uORF and a so-far unannotated CDS initiation codon. MATERIALS AND METHODSCell culture.NIH3T3 and HEK293FT cells were cultured under standard conditions (DMEM; 10% FCS, 1% penicillin/streptomycin, all from Invitrogen; 37 o C; 5% CO 2 ). Lentiviral particle production in HEK293FT cells using envelope pMD2.G and packaging psPAX2 plasmids, and viral transduction of NIH3T3 cells, were performed following published protocols (10), with puromycin selection at 5 µg/ml for 4 days. Cloning and plasmids.For the generation of lentiviral shRNA expression vectors, two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)): shRNA1: GTACCACAGAAGGTCACGATA, corresponding to clone TRCN0000308443 of the TRC shRNA Library from the Broad Institute; and shRNA2: GTGCCAAGTTAGATGCGGATT, corresponding to clone TRCN0000098826. pLKO.1puro constructs containing Gfp, and Scramble (Addgene no. 1864) shRNAs served as controls.For the generation of dual luciferase (Firefly/Renilla) reporter plasmids, fragments containing the 5' UTR and first 5-14 codons of the selected DENR targets/controls were amplified by PCR from genomic DNA or cDNA, cloned into the BamHI site of the prLV1 dual luciferase reporter plasmid (12), and validated by sequencing. The following primers were used for PCR: Etaa1, forward (for): aaaggatccGACTTGCAA AGATGGCGCTGCAC, reverse (rev): tttggatccactagtGTCCT TCAGCTGCATTCACATTT; Map2k5, for: aaaggatccGGTT CCGGAGTAACAGCGGTCTAAC, rev: tttggatccactagtGGC CAGCCACAGCATTACAGGTTAA; Lrrc28, for: aaaggatcc GCCGCTGAGTGCCGGTCAGCGGGC, rev: tttggatccactag tGATTTCGGATGCCATGACTGAACA; Klhdc8a, for: aaag gatccGTCTCCGACCCTGTAGACACTGCAG, rev: tttggatc cactagtA...
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.