COVID-19: public health management of the first two confirmed cases identified in the UK

Holden, Ben; Quinney, Anne; Padfield, Simon; Morton, W; Coles, Simon J.; Manley, Petra; Wensley, Adrian; Hutchinson, C. E.; Lillie, Patrick; Duncan, Christopher J A; Schmid, Matthias; Li, A.; Foster, Kirsty; Anaraki, Sudy; Dabrera, Gavin; Zambon, Maria; Hughes, G.; Gent, Mike

doi:10.1017/s0950268820001922

Cited by 8 publications

(7 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Public Health England strain SARS‐CoV‐2 (strain name: England 02/20) (Holden et al , 2020 ) was isolated on VeroE6 cells and passaged three subsequent times on Vero E6 cells to passage four (P4). During passage, “PHE” lost the polybasic cleavage site in spike and whole genome sequencing and minor variant analysis further identified a population (~ 8%) harbouring an out‐of‐frame 27 nucleotide deletion (CTATACATGTCTCTGGGACCAATGGTA) resulting in a loss of 9 amino acids in the N2 loop AIHVSGTNG (Δ67–76) (Bamford et al , 2022 ).…”

Section: Methodsmentioning

confidence: 99%

Evolutionary remodelling of N‐terminal domain loops fine‐tunes SARS‐CoV‐2 spike

et al. 2022

View full text Add to dashboard Cite

The emergence of SARS-CoV-2 variants has exacerbated the COVID-19 global health crisis. Thus far, all variants carry mutations in the spike glycoprotein, which is a critical determinant of viral transmission being responsible for attachment, receptor engagement and membrane fusion, and an important target of immunity. Variants frequently bear truncations of flexible loops in the N-terminal domain (NTD) of spike; the functional importance of these modifications has remained poorly characterised. We demonstrate that NTD deletions are important for efficient entry by the Alpha and Omicron variants and that this correlates with spike stability. Phylogenetic analysis reveals extensive NTD loop length polymorphisms across the sarbecoviruses, setting an evolutionary precedent for loop remodelling. Guided by these analyses, we demonstrate that variations in NTD loop length, alone, are sufficient to modulate virus entry. We propose that variations in NTD loop length act to fine-tune spike; this may provide a mechanism for SARS-CoV-2 to navigate a complex selection landscape encompassing optimisation of essential functionality, immunedriven antigenic variation and ongoing adaptation to a new host.

show abstract

Section: Methodsmentioning

confidence: 99%

Evolutionary remodelling of N‐terminal domain loops fine‐tunes SARS‐CoV‐2 spike

et al. 2022

View full text Add to dashboard Cite

show abstract

“…However, much of our understanding using in vitro models of SARS-CoV-2 evolution is from cell cultures derived from adults. Therefore, questions remain concerning the consequences of passage in paediatric cultures, especially as children have distinct outcomes following SARS-CoV-2 infection [24][25][26][27][28].…”

Section: Discussionmentioning

confidence: 99%

“…This stock was from a sample isolated on VeroE6 cells and represents one of the earliest isolates of SARS-CoV-2 in the UK during the pandemic. PHE is from clade A and does not contain the D614G substitution in Spike (Supplementary Table S1) [23,24]. Upon receipt, we carried out a further three passages on VeroE6 cells passaging at an MOI of 0.001, harvesting stocks at 96 hpi when extensive cytopathic effects were observed.…”

Section: Isolation and Passage Of Sars-cov-2 In Unmodified Vero-deriv...mentioning

confidence: 99%

Comparison of SARS-CoV-2 Evolution in Paediatric Primary Airway Epithelial Cell Cultures Compared with Vero-Derived Cell Lines

Bamford

Broadbent

Aranday-Cortes

et al. 2022

Viruses

View full text Add to dashboard Cite

SARS-CoV-2 can efficiently infect both children and adults, albeit with morbidity and mortality positively associated with increasing host age and presence of co-morbidities. SARS-CoV-2 continues to adapt to the human population, resulting in several variants of concern (VOC) with novel properties, such as Alpha and Delta. However, factors driving SARS-CoV-2 fitness and evolution in paediatric cohorts remain poorly explored. Here, we provide evidence that both viral and host factors co-operate to shape SARS-CoV-2 genotypic and phenotypic change in primary airway cell cultures derived from children. Through viral whole-genome sequencing, we explored changes in genetic diversity over time of two pre-VOC clinical isolates of SARS-CoV-2 during passage in paediatric well-differentiated primary nasal epithelial cell (WD-PNEC) cultures and in parallel, in unmodified Vero-derived cell lines. We identified a consistent, rich genetic diversity arising in vitro, variants of which could rapidly rise to near fixation within two passages. Within isolates, SARS-CoV-2 evolution was dependent on host cells, with paediatric WD-PNECs showing a reduced diversity compared to Vero (E6) cells. However, mutations were not shared between strains. Furthermore, comparison of both Vero-grown isolates on WD-PNECs disclosed marked growth attenuation mapping to the loss of the polybasic cleavage site (PBCS) in Spike, while the strain with mutations in Nsp12 (T293I), Spike (P812R) and a truncation of Orf7a remained viable in WD-PNECs. Altogether, our work demonstrates that pre-VOC SARS-CoV-2 efficiently infects paediatric respiratory epithelial cells, and its evolution is restrained compared to Vero (E6) cells, similar to the case of adult cells. We highlight the significant genetic plasticity of SARS-CoV-2 while uncovering an influential role for collaboration between viral and host cell factors in shaping viral evolution and ultimately fitness in human respiratory epithelium.

show abstract

“…A total of 7 lessons, derived from 29 studies [9][10][11][12][13]20,27,28,31,45,55,64,67,70,72,73,75,78,84,85,87,111,112,122,134,[136][137][138][139] and quoted on 50 single occasions, were referred to this pillar: among them, 8 citations were referred to AFRO region, 4 to EMRO region, 10 to EURO region, 15 to AMRO region, 11 to SEARO, and 2 to WPRO region (see Figure S7).…”

Section: Pillar 7: Case Management Clinical Operations and Therapeuticsmentioning

confidence: 99%

Lessons Learned from the Lessons Learned in Public Health during the First Years of COVID-19 Pandemic

Marcassoli

Leonardi

Passavanti

et al. 2023

IJERPH

View full text Add to dashboard Cite

(1) Objectives: to investigate the main lessons learned from the public health (PH) response to COVID-19, using the global perspective endorsed by the WHO pillars, and understand what countries have learned from their practical actions. (2) Methods: we searched for articles in PubMed and CINAHL from 1 January 2020 to 31 January 2022. 455 articles were included. Inclusion criteria were PH themes and lessons learned from the COVID-19 pandemic. One hundred and forty-four articles were finally included in a detailed scoping review. (3) Findings: 78 lessons learned were available, cited 928 times in the 144 articles. Our review highlighted 5 main lessons learned among the WHO regions: need for continuous coordination between PH institutions and organisations (1); importance of assessment and evaluation of risk factors for the diffusion of COVID-19, identifying vulnerable populations (2); establishment of evaluation systems to assess the impact of planned PH measures (3); extensive application of digital technologies, telecommunications and electronic health records (4); need for periodic scientific reviews to provide regular updates on the most effective PH management strategies (5). (4) Conclusion: lessons found in this review could be essential for the future, providing recommendations for an increasingly flexible, fast and efficient PH response to a healthcare emergency such as the COVID-19 pandemic.

show abstract

COVID-19: public health management of the first two confirmed cases identified in the UK

Cited by 8 publications

References 10 publications

Evolutionary remodelling of N‐terminal domain loops fine‐tunes SARS‐CoV‐2 spike

Evolutionary remodelling of N‐terminal domain loops fine‐tunes SARS‐CoV‐2 spike

Comparison of SARS-CoV-2 Evolution in Paediatric Primary Airway Epithelial Cell Cultures Compared with Vero-Derived Cell Lines

Lessons Learned from the Lessons Learned in Public Health during the First Years of COVID-19 Pandemic

Contact Info

Product

Resources

About