Correlation between Ureaplasma Subgroup 2 and Genitourinary Tract Disease Outcomes Revealed by an Expanded Multilocus Sequence Typing (eMLST) Scheme

Abstract

The multilocus sequence typing (MLST) scheme of Ureaplasma based on four housekeeping genes (ftsH, rpL22, valS, and thrS) was described in our previous study; here we introduced an expanded MLST (eMLST) scheme with improved discriminatory power, which was developed by adding two putative virulence genes (ureG and mba-np1) to the original MLST scheme. To evaluate the discriminatory power of eMLST, a total of 14 reference strains of Ureaplasma serovars and 269 clinical strains (134 isolated from symptomatic patients and 135 obtained from asymptomatic persons) were investigated. Our study confirmed that all 14 serotype strains could successfully be differentiated into 14 eMLST STs (eSTs), while some of them could not even be differentiated by the MLST, and a total of 136 eSTs were identified among the clinical isolates we investigated. In addition, phylogenetic analysis indicated that two genetically significantly distant clusters (cluster I and II) were revealed and most clinical isolates were located in cluster I. These findings were in accordance with and further support for the concept of two well-known genetic lineages (Ureaplasma parvum and Ureaplasma urealyticum) in our previous study. Interestingly, although both clusters were associated with clinical manifestation, the sub-group 2 of cluster II had pronounced and adverse effect on patients and might be a potential risk factor for clinical outcomes. In conclusion, the eMLST scheme offers investigators a highly discriminative typing tool that is capable for precise epidemiological investigations and clinical relevance of Ureaplasma.

Antibiotic Susceptibility and Sequence Type Distribution of Ureaplasma Species Isolated from Genital Samples in Switzerland

“…However, we note that information regarding the distribution of STs for Ureaplasma spp. is limited to the Chinese data provided by the aforementioned authors (14 reference strains and 269 isolates analyzed), and nothing is known about other geographical regions (16,32).…”

Detection of Ureaplasma spp. serovars in genital tract of infertile males

“…The culture of Ureaplasma species was performed by using a commercially available Mycoplasma IST 2 kit (bioMérieux, Marcy L'etoile, France). Genomic DNA was extracted by the proteinase K method as described in our previous study . Briefly, a total of 0.5 mL of Ureaplasma spp.…”

“…The supernatant was utilized immediately or stored a −80°C for future use. To distinguish UPA from UUR in isolates of urethral swabs samples, two primer pairs UMS‐125 (GTATTTGCAATCTTTATATGTTTTCG), UMA226 (CAG CTGATGTAAGTGCAGCATTAAATTC), and UMS‐51 (CTGAGCTAT GACATTAGGTGTTACC), UMA 427 (ACCTGGTTGTGTAGTTTCAAAGTTCAC) were used as described by Teng et al Amplifications were carried out according to the Taq DNA Polymerases (Takara, Japan) protocol as described in our previous study . UPA and UUR were then typed for their corresponding serovars by a series of serovar‐specific real‐time PCR assays, using the Roche LightCycler 2.0 .…”

“…Genomic DNA was extracted by the proteinase K method as described in our previous study. 10 Briefly, a total of 0.5 mL of Ureaplasma spp. broth culture of each Ureaplasma spp.…”

“…To distinguish UPA from UUR in isolates of urethral swabs samples, two primer pairs UMS-125 (GTATTTGCAATCTTTATATGTTTTCG), UMA226 (CAG CTGATGTAAGTGCAGCATTAAATTC), and UMS-51 (CTGAGCTAT GACATTAGGTGTTACC), UMA 427 (ACCTGGTTGTGTA GTTTCAAAGTTCAC) were used as described by Teng et al 11 Amplifications were carried out according to the Taq DNA Polymerases (Takara, Japan) protocol as described in our previous study. 10…”