Control of basal autophagy by calpain1 mediated cleavage of ATG5

Xia, Hongguang; Zhang, Lihong; Chen, Gang; Zhang, Tao; Liu, Junli; Jin, Mingzhi; Ma, Xiuquan; Ma, Dawei; Yuan, Junying

doi:10.4161/auto.6.1.10326

Cited by 176 publications

(155 citation statements)

References 21 publications

Supporting

Mentioning

143

Contrasting

Unclassified

Order By: Relevance

“…The acetylation is dependent on the activity of p300 [126], and the deacetylation is probably under the control of the histone deacetylase sirtuin 1 [127]. Atg5, Atg7, and Beclin 1 are substrates for calpains [128][129][130], and Atg4D and Beclin 1 are substrates for caspases [120,131,132]. The cleavage of Beclin 1 by caspase 3 and that of Atg5 by calpain 1 inhibit autophagy [120,130].…”

Section: Other Cytoplasmic Autophagy Regulation Mechanismsmentioning

confidence: 99%

“…Atg5, Atg7, and Beclin 1 are substrates for calpains [128][129][130], and Atg4D and Beclin 1 are substrates for caspases [120,131,132]. The cleavage of Beclin 1 by caspase 3 and that of Atg5 by calpain 1 inhibit autophagy [120,130]. The cleavage of Atg proteins by caspases and calpains has been proposed as a possible additional mechanism modulating autophagy.…”

Section: Other Cytoplasmic Autophagy Regulation Mechanismsmentioning

confidence: 99%

See 1 more Smart Citation

Overview of macroautophagy regulation in mammalian cells

et al. 2010

View full text Add to dashboard Cite

Macroautophagy is a multistep, vacuolar, degradation pathway terminating in the lysosomal compartment, and it is of fundamental importance in tissue homeostasis. In this review, we consider macroautophagy in the light of recent advances in our understanding of the formation of autophagosomes, which are double-membrane-bound vacuoles that sequester cytoplasmic cargos and deliver them to lysosomes. In most cases, this final step is preceded by a maturation step during which autophagosomes interact with the endocytic pathway. The discovery of AuTophaGyrelated genes has greatly increased our knowledge about the mechanism responsible for autophagosome formation, and there has also been progress in the understanding of molecular aspects of autophagosome maturation. Finally, the regulation of autophagy is now better understood because of the discovery that the activity of Atg complexes is targeted by protein kinases, and owing to the importance of nuclear regulation via transcription factors in regulating the expression of autophagy genes.

show abstract

Section: Other Cytoplasmic Autophagy Regulation Mechanismsmentioning

confidence: 99%

Section: Other Cytoplasmic Autophagy Regulation Mechanismsmentioning

confidence: 99%

Overview of macroautophagy regulation in mammalian cells

et al. 2010

View full text Add to dashboard Cite

show abstract

“…Also fragments resulting from proteolytic cleavage of typical Atg proteins can enhance apoptotic cell death. Truncated Atg5, Atg4D and Beclin-1 localize at the mitochondria and trigger apoptosis, for example by release of pro-apoptotic factors from mitochondria [133][134][135][136]. Finally, autophagy can also assist in the clearance of apoptotic cells.…”

Section: Atg12-atg3mentioning

confidence: 99%

Autophagy: for better or for worse

et al. 2011

View full text Add to dashboard Cite

Autophagy is a lysosomal degradation pathway that degrades damaged or superfluous cell components into basic biomolecules, which are then recycled back into the cytosol. In this respect, autophagy drives a flow of biomolecules in a continuous degradation-regeneration cycle. Autophagy is generally considered a pro-survival mechanism protecting cells under stress or poor nutrient conditions. Current research clearly shows that autophagy fulfills numerous functions in vital biological processes. It is implicated in development, differentiation, innate and adaptive immunity, ageing and cell death. In addition, accumulating evidence demonstrates interesting links between autophagy and several human diseases and tumor development. Therefore, autophagy seems to be an important player in the life and death of cells and organisms. Despite the mounting knowledge about autophagy, the mechanisms through which the autophagic machinery regulates these diverse processes are not entirely understood. In this review, we give a comprehensive overview of the autophagic signaling pathway, its role in general cellular processes and its connection to cell death. In addition, we present a brief overview of the possible contribution of defective autophagic signaling to disease.

show abstract

“…The following target sequences (5Ј to 3Ј) were used. The three calpain-1 siRNAs were duplex A (CCACGGAACTGCTGTCAAA) (49), duplex B (AAGCTAGTGTTCGTGCA CTCTGCC), and duplex C (GGGACTTGTGTACTGGTTATT). One Rad21 siRNA sequence was AGAGTTGGATAGCAAGACA (targeting the coding region [CR]), and a combination of three duplexes targeting the Rad21 3Ј untranslated region (3Ј-UTR) were used to effectively deplete endogenous Rad21: GCAAAGTTAACACTGAAAGTTCTAG, AGCATTATAGCTAGTG TTTGATTCA, and GGATGGTATCTGAAACAACAATGGT (all custom synthesized by Integrated DNA Technologies, San Diego, CA).…”

Section: Cellmentioning

confidence: 99%

Calpain-1 Cleaves Rad21 To Promote Sister Chromatid Separation

Panigrahi

Zhang

Mao

et al. 2011

Molecular and Cellular Biology

View full text Add to dashboard Cite

Defining the mechanisms of chromosomal cohesion and dissolution of the cohesin complex from chromatids is important for understanding the chromosomal missegregation seen in many tumor cells. Here we report the identification of a novel cohesin-resolving protease and describe its role in chromosomal segregation. Sister chromatids are held together by cohesin, a multiprotein ring-like complex comprised of Rad21, Smc1, Smc3, and SA2 (or SA1). Cohesin is known to be removed from vertebrate chromosomes by two distinct mechanisms, namely, the prophase and anaphase pathways. First, PLK1-mediated phosphorylation of SA2 in prophase leads to release of cohesin from chromosome arms, leaving behind centromeric cohesins that continue to hold the sisters together. Then, at the onset of anaphase, activated separase cleaves the centromeric cohesin Rad21, thereby opening the cohesin ring and allowing the sister chromatids to separate. We report here that the calcium-dependent cysteine endopeptidase calpain-1 is a Rad21 peptidase and normally localizes to the interphase nuclei and chromatin. Calpain-1 cleaves Rad21 at L192, in a calcium-dependent manner. We further show that Rad21 cleavage by calpain-1 promotes separation of chromosome arms, which coincides with a calcium-induced partial loss of cohesin at several chromosomal loci. Engineered cleavage of Rad21 at the calpain-cleavable site without activation of calpain-1 can lead to a loss of sister chromatid cohesion. Collectively, our work reveals a novel function of calpain-1 and describes an additional pathway for sister chromatid separation in humans.DNA replication in S phase generates two identical molecules of chromosomal DNA, known as sister chromatids, which must equally segregate to the two daughter cells in the subsequent mitosis. Therefore, it is important that the sister chromatids are held together from the S phase until proper kinetochore assembly is complete. Such cohesion of the sisters is mediated by a multiprotein ring-like complex called cohesin, which is conserved from Saccharomyces cerevisiae to humans. Cohesin is comprised of four core proteins, namely, Rad21 (Scc1/Mcd1), Smc1, Smc3, and either SA2/Stag2 or SA1/Stag1 (13,22,25,39; reviewed in reference 28). Cohesin undergoes a series of physical and chemical changes during the course of the cell cycle in order to orchestrate the dynamic cohesion and separation between the sister chromatids that are essential for high-fidelity transmission of the genetic material (32). The cohesin cycle includes loading cohesins onto the chromatin of the unpaired chromosome, forming cohesion between the sister chromatids in S phase, regulated freeing of chromosome arms in early mitosis, separation of sister chromatids to allow segregation to opposite poles, and recycling of cohesin molecules for subsequent usage.Cohesin is loaded onto the chromatin in G 1 phase in yeast (25) and in late telophase in vertebrates (21, 39). Loading of cohesin onto chromatin depends on two proteins, Scc2 and Scc4 (8,46). Once it is loaded onto...

show abstract

Control of basal autophagy by calpain1 mediated cleavage of ATG5

Cited by 176 publications

References 21 publications

Overview of macroautophagy regulation in mammalian cells

Overview of macroautophagy regulation in mammalian cells

Autophagy: for better or for worse

Calpain-1 Cleaves Rad21 To Promote Sister Chromatid Separation

Contact Info

Product

Resources

About