Continuous Influenza Virus Production in Cell Culture Shows a Periodic Accumulation of Defective Interfering Particles

Abstract

Influenza viruses are a major public health burden during seasonal epidemics and a continuous threat due to their potential to cause pandemics. Annual vaccination provides the best protection against the contagious respiratory illness caused by influenza viruses. However, the current production capacities for influenza vaccines are insufficient to meet the increasing demands. We explored the possibility to establish a continuous production process for influenza viruses using the duck-derived suspension cell line AGE1.CR. A two-stage bioreactor setup was designed in which cells were cultivated in a first stirred tank reactor where an almost constant cell concentration was maintained. Cells were then constantly fed to a second bioreactor where virus infection and replication took place. Using this two-stage reactor system, it was possible to continuously produce influenza viruses. Surprisingly, virus titers showed a periodic increase and decrease during the run-time of 17 days. These titer fluctuations were caused by the presence of defective interfering particles (DIPs), which we detected by PCR. Mathematical modeling confirmed this observation showing that constant virus titers can only emerge in the absence of DIPs. Even with very low amounts of DIPs in the seed virus and very low rates for de novo DIP generation, defective viruses rapidly accumulate and, therefore, represent a serious challenge for continuous vaccine production. Yet, the continuous replication of influenza virus using a two-stage bioreactor setup is a novel tool to study aspects of viral evolution and the impact of DIPs.

Particle quantification of influenza viruses by high performance liquid chromatography

“…Furthermore, the World Health Organization (WHO) has established an action plan in 2006 to increase the current supply of influenza vaccine to 2 billion doses by 2015, which highlights the need to develop new technologies capable to support urgent and large demands for vaccines [6]. Therefore, several alternatives for rapid production have been developed or are being explored [7][8][9][10][11][12]. Some of these innovative production platforms only require 2-3 weeks to http://dx.doi.org/10.1016/j.vaccine.2014.…”

“…Some of these innovative production platforms only require 2-3 weeks to http://dx.doi.org/10.1016/j.vaccine.2014. 11.027 0264-410X/© 2014 Elsevier Ltd. All rights reserved. generate a new vaccine lot [13][14][15].…”

Plasmacytoid Dendritic Cells Require Direct Infection To Sustain the Pulmonary Influenza A Virus-Specific CD8 T Cell Response

“…Defective interfering genomes have been demonstrated to be produced following IAV infection and can stimulate innate immune responses and enhance DC maturation, which could modulate induction of antiviral CD8 T cell responses (16,18,19). Therefore, differences in the amounts of defective genomes produced in the lungs of DC donors infected with ctrl-or 142t-IAV could potentially lead to alterations in antigen presentation capabilities of DC subsets.…”

“…The SuperScript III One-Step reverse transcription-PCR (RT-PCR) system with Platinum Taq DNA polymerase (Invitrogen) was used to convert A/Puerto Rico/ 8/34 viral RNA samples into cDNA and to amplify the cDNA by PCR. The PB2 and NA gene segments were amplified from each of the samples utilizing the following previously described primers: for PB2, 5=-GTAGA TGCAGCGAAAGCAGGTCAATTAT and 3=-GTAGCAGCAGTAGAAA CAAGGTCGTTTT, and for NA, 5=-GTAGATGCAGCGAAAGCAGGGG TTTAAA and 3=-GTAGCAGCAGTAGAAACAAGGAGTTTTT (16). The samples were then loaded onto a 1% agarose gel with 0.012% ethidium bromide and run in Tris-acetate-EDTA buffer, and PB2 primer 3=-GTA GCAGCAGTAGAAACAAGGTCGTTTT was imaged on a Cell Biosciences gel doc.…”

Cell substrates for the production of viral vaccines

“…Conversely, perfusion cell cultivation mode enables a constant renewing of fresh medium and product harvesting, thereby allowing maintenance of cells in culture for a longer period, which is particularly advantageous for slow replicating viruses. As an ultimate process development strategy, an even more continuous culture system was tested by Frensing et al [73] consisting in a steady and continuing supply of cells along the run. With this concept, the production of higher virus quantity is expected in a given production campaign leading to beneficial reduced manufacturing scale to implement in the facility.…”