Construction of Onchocerca volvulus cDNA libraries and partial characterization of the cDNA for a major antigen

Donelson, John E.; Duke, B. O. L.; Moser, D R; Zeng, Wenlin; Erondu, Ngozi; Lucius, Richard; Renz, Alfons; Karam, M; Flores, Guillermo Zea

doi:10.1016/0166-6851(88)90154-5

Cited by 76 publications

(23 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…3, solid ****************************************GATCTGTCAAGTTGAATAGTTTTTTGGGCCTGTTAGTATTTGACTCTAAGATAGCTTGGAAATTCCTCGAG GTCTACGACCATAMkCGTTGAAAGCACGACATCTCCTCCCATCTGTCAAGTT-AAGCAACGTTGWCCTGGTTAGTA==ATCGGAGACGGCCTGGGAATCCCAGGTG VOL. 10 Fig. 5.…”

Section: Resultsmentioning

confidence: 99%

“…We suspect that this negative result is because small A. 5 RNAs are lost in the procedure we used to simultaneously extract RNA and DNA from adult 0. volvulus (10) (Fig. 6).…”

Section: Ttgtagtcaaggttacgcgccaaaaaagagcgctctt---gcgctaaaaatagcgccttamentioning

confidence: 99%

“…Polymerase chain reaction (PCR) amplification of actin mRNA sequences was conducted by synthesizing firststrand cDNA from adult 0. volvulus poly(A)+ RNA with reverse transcriptase and oligo(dT) (10). This first-strand cDNA served as the template for the PCR with an SL oligonucleotide and an oligonucleotide containing a consensus complementary actin coding sequence about 200 nucleotides downstream from the ATG start codon (24).…”

mentioning

confidence: 99%

“…Onchocerca (10). Briefly, the cDNA library was prepared by synthesis of first-and second-strand cDNAs by using avian myeloblastosis virus reverse transcriptase and Escherichia coli DNA polymerase I, respectively, digestion with Si nuclease, addition of EcoRI linkers, and ligation of the duplex cDNAs into Xgtll.…”

mentioning

confidence: 99%

See 3 more Smart Citations

Many transcribed regions of the Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis elegans.

Zeng¹,

Alarcon²,

Donelson³

1990

Mol. Cell. Biol.

View full text Add to dashboard Cite

Section: Resultsmentioning

confidence: 99%

“…We suspect that this negative result is because small A. 5 RNAs are lost in the procedure we used to simultaneously extract RNA and DNA from adult 0. volvulus (10) (Fig. 6).…”

Section: Ttgtagtcaaggttacgcgccaaaaaagagcgctctt---gcgctaaaaatagcgccttamentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Many transcribed regions of the Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis elegans.

Zeng¹,

Alarcon²,

Donelson³

1990

Mol. Cell. Biol.

View full text Add to dashboard Cite

“…Immunoscreening of cDNA libraries, constructed from adult worms (18) and more recently from L3 (SAW94WL-OvL3), using polyclonal antibodies has resulted in the identification of more than 50 O. volvulus antigens (http://helios.bto .ed.ac.uk/mbx/fgn/OnchoNet/onchotable1.html). About 10 of the proteins are also present in larval stages of O. volvulus, some of which have been shown to confer partial protection against L3 challenge in surrogate rodent models of onchocercal infections (34,39,70,71).…”

mentioning

confidence: 99%

Identification of Potential Vaccine and Drug Target Candidates by Expressed Sequence Tag Analysis and Immunoscreening ofOnchocerca volvulusLarval cDNA Libraries

et al. 2000

View full text Add to dashboard Cite

The search for appropriate vaccine candidates and drug targets against onchocerciasis has so far been confronted with several limitations due to the unavailability of biological material, appropriate molecular resources, and knowledge of the parasite biology. To identify targets for vaccine or chemotherapy development we have undertaken two approaches. First, cDNA expression libraries were constructed from life cycle stages that are critical for establishment of Onchocerca volvulus infection, the third-stage larvae (L3) and the molting L3. A gene discovery effort was then initiated by random expressed sequence tag analysis of 5,506 cDNA clones. Cluster analyses showed that many of the transcripts were up-regulated and/or stage specific in either one or both of the cDNA libraries when compared to the microfilariae, L2, and both adult stages of the parasite. Homology searches against the GenBank database facilitated the identification of several genes of interest, such as proteinases, proteinase inhibitors, antioxidant or detoxification enzymes, and neurotransmitter receptors, as well as structural and housekeeping genes. Other O. volvulus genes showed homology only to predicted genes from the free-living nematode Caenorhabditis elegans or were entirely novel. Some of the novel proteins contain potential secretory leaders. Secondly, by immunoscreening the molting L3 cDNA library with a pool of human sera from putatively immune individuals, we identified six novel immunogenic proteins that otherwise would not have been identified as potential vaccinogens using the gene discovery effort. This study lays a solid foundation for a better understanding of the biology of O. volvulus as well as for the identification of novel targets for filaricidal agents and/or vaccines against onchocerciasis based on immunological and rational hypothesis-driven research.

show abstract

Onchocerca volvulus: Limited Heterogeneity in the Nuclear and Mitochondrial Genomes

Keddie

Higazi

Boakye

et al. 1999

Experimental Parasitology

View full text Add to dashboard Cite

Construction of Onchocerca volvulus cDNA libraries and partial characterization of the cDNA for a major antigen

Cited by 76 publications

References 24 publications

Many transcribed regions of the Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis elegans.

Many transcribed regions of the Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis elegans.

Identification of Potential Vaccine and Drug Target Candidates by Expressed Sequence Tag Analysis and Immunoscreening ofOnchocerca volvulusLarval cDNA Libraries

Onchocerca volvulus: Limited Heterogeneity in the Nuclear and Mitochondrial Genomes

Contact Info

Product

Resources

About