Construction of a Radiation Hybrid Map of Chromosome 9p

Bouzyk, Mark; Bryant, Stephen P.; Schmitt, Karin; Goodfellow, Peter N.; Ekong, Rosemary; Spurr, Nigel K.

doi:10.1006/geno.1996.0264

Cited by 10 publications

(12 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…HepG2 cells were exposed to 80 Gy of irradiation at room temperature using a Hitachi MBR1520R X-ray unit (Bouzyk et al, 1996). They were then fused with Hepa-1/6TG r cells, as described above.…”

Section: Generation Of Hybrids Containing X-ray Irradiation-induced Fmentioning

confidence: 99%

“…Because different hybrid cell lines contain different sets of human chromosomes, by analyzing several hybrid cell lines we can narrow down the human chromosome that harbors a responsible gene for CYP1A1 induction by omeprazole treatment. Furthermore, we can localize the gene on the chromosome using radiation hybrid cells, which contain human chromosomes fragmented by X-ray irradiation (Bouzyk et al, 1996).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Presence on human chromosome 10 of omeprazole-sensitivity gene whose product mediates CYP1A1 induction

Kikuchi

Fukushige²,

Shibazaki³

et al. 2002

Cytogenet Genome Res

View full text Add to dashboard Cite

Previously, we showed that CYP1A1 expression can be induced by omeprazole (OP) in the human cell line HepG2, but not in the mouse cell line Hepa-1. Now we show induction of CYP1A1 by α-naphthoflavone (αNF) in Hepa-1 cells. This induction was inhibited by the tyrosine kinase inhibitor herbimycin A, but not by the aromatic hydrocarbon (Ah)-receptor antagonist PD98059, suggesting the presence of a ligand-independent signal-transduction pathway in the mouse cell line too. We utilized the lack of CYP1A1 induction by OP in Hepa-1 cells to map a putative human gene for OP-respon- siveness in cell hybrids produced by fusion of Hepa-1 and HepG2 cells. OP-induced CYP1A1 expression was detected in four out of the 32 Hepa-1 × HepG2 cell hybrids analyzed. To help identify the gene locus, a radiation-hybrid cell (E11) was constructed. Use of reverse-fluorescence in situ hybridization revealed that these five cell lines commonly retained human chromosome 10p. These results suggest that the human gene for OP-responsiveness is present on chromosome 10p.

show abstract

Section: Generation Of Hybrids Containing X-ray Irradiation-induced Fmentioning

confidence: 99%

mentioning

confidence: 99%

Presence on human chromosome 10 of omeprazole-sensitivity gene whose product mediates CYP1A1 induction

Kikuchi

Fukushige²,

Shibazaki³

et al. 2002

Cytogenet Genome Res

View full text Add to dashboard Cite

show abstract

“…The 96-well 'microtiter format' was used with a Beckman 1000 Biomek robot to aliquot DNA for rapid PCR analysis. Primer sequences for all DNA fragment markers, ESTs and genes can be found in GDB (URL http://gdbwww.gdb.org/) or by referring to Bouzyk et al [21]. Primers 5'TACACCAGGATCAAG-AAGGC3' and 5 AGAGAAACCGAGAAGAAACC3' for RD55 were designed by Vivienne Watson [pers.…”

Section: Growth Of Yac and Yac Dna Preparationmentioning

confidence: 99%

“…Polymerase Chain Reaction RH clones had been previously characterized by T/«-specific PCR for human content [21], The presence or absence of single-copy loci in the RH or YAC panels was determined by PCR. Each marker was screened in duplicate.…”

Section: Growth Of Yac and Yac Dna Preparationmentioning

confidence: 99%

“…More recently, the constitutional 9p syn drome was located between D9S267 and D9S286, and a sex determination gene was placed between SNF2L2 and D9S144 [1], Several maps which include chromosome 9p as a com ponent of genome-wide efforts have been published. These include genetic linkage maps based on meiotic recombination in the CEPH families [14][15][16], a Géné-thon-Cambridge University radiation hybrid (RH) map [17], a CEPH YAC map [18], an integrated sequence-tag ged site (STS) YAC-RH map produced by the Whitehead Institute and Généthon [ 19] and a gene map produced by an intemationl consortium [20], We wished to exploit the information on these maps by firstly improving on the previously published RH map of chromosome 9p [21] with the addition of new markers on the framework map and subsequently refining the localization of these and previous markers. The second step would be to use this new and improved RH map as a basis for constructing a YAC minimal tiling path across the whole of the short arm of chromosome 9.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation