Construction and functional analysis of pathogen-inducible synthetic promoters in Brassica napus

Shokouhifar, Farhad; Zamani, Mohammadreza; Motallebi, Mostafa; Mousavi, Amir; Malboobi, M. A.

doi:10.1007/s10535-011-0169-5

Cited by 18 publications

(16 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There are many factors that have effects on transcriptional properties of SPIP, such as cis-element function, cis-element copy number, space to TATA-box, location relative to their regulatory targets, etc. (Shokouhifar et al 2011). At present, except for the position of V-box, all other factors were exactly the same in the constructs of the three modified SPIPs (Fig.…”

mentioning

confidence: 58%

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Huang¹,

Li²

2020

Biologia plant.

View full text Add to dashboard Cite

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col-0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level).

show abstract

mentioning

confidence: 58%

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Huang¹,

Li²

2020

Biologia plant.

View full text Add to dashboard Cite

show abstract

“…Likewise, by coupling two cis-acting elements (E17 and F) upstream of the CaMV 35S minimal promoter, Shokouhifar et al (2011) devised synthetic plant promoters (SP-EE, SP-FF and SP-FFEE) that have high potential for use as biotrophic-sensitive and pathogen-inducible promoters in canola plants; these promoters were induced by exposure to chitin, plant defense-signaling factors and crude elicitors derived from Sclerotinia sclerotiorum, Rhizoctonia solani and Fusarium graminearum pathogens. Overall, chitin induced approximately 3.5-, 1.4-and 1.6-fold increased activity in SP-FF, SP-EE and SP-FFEE, respectively, compared to untreated synthetic promoters.…”

Section: Biotic Stress-inducible Synthetic Promotersmentioning

confidence: 99%

Synthetic promoters in planta

Dey

Sarkar

Acharya

et al. 2015

Planta

View full text Add to dashboard Cite

This paper reviews the importance, prospective and development of synthetic promoters reported in planta. A review of the synthetic promoters developed in planta would help researchers utilize the available resources and design new promoters to benefit fundamental research and agricultural applications. The demand for promoters for the improvement and application of transgenic techniques in research and agricultural production is increasing. Native/naturally occurring promoters have some limitations in terms of their induction conditions, transcription efficiency and size. The strength and specificity of native promoter can be tailored by manipulating its 'cis-architecture' by the use of several recombinant DNA technologies. Newly derived chimeric promoters with specific attributes are emerging as an efficient tool for plant molecular biology. In the last three decades, synthetic promoters have been used to regulate plant gene expression. To better understand synthetic promoters, in this article, we reviewed promoter structure, the scope of cis-engineering, strategies for their development, their importance in plant biology and the total number of such promoters (188) developed in planta to date; we then categorized them under different functional regimes as biotic stress-inducible, abiotic stress-inducible, light-responsive, chemical-inducible, hormone-inducible, constitutive and tissue-specific. Furthermore, we identified a set of 36 synthetic promoters that control multiple types of expression in planta. Additionally, we illustrated the differences between native and synthetic promoters and among different synthetic promoter in each group, especially in terms of efficiency and induction conditions. As a prospective of this review, the use of ideal synthetic promoters is one of the prime requirements for generating transgenic plants suitable for promoting sustainable agriculture and plant molecular farming.

show abstract

“…PCR product was digested with XhoI/SacI and subcloned in the pGPTV-gus int vector (Sprenger-Haussels and Weisshaar, 2000); this construct was named pG-KSgus int (Figure 1a). In the second step, the synthetic fragment containing the SP-DDEE inducible promoter sequence (Shokouhifar et al, 2011), the loxP sequence, and the nos terminator was digested with DraIII and subcloned in pG-KSgus int . The new construct was named pG-synDDEE-KSgus int ( Figure 1b).…”

Section: Construction Of Pg-synddee-cre Int -Gus Intmentioning

confidence: 99%

Efficient seed-specifically regulated autoexcision of marker gene (nptII) with inducible expression of interest gene in transgenic Nicotiana tabacum

Hamzeh¹,

Motallebi²,

Zamani³

2016

Turk J Biol

View full text Add to dashboard Cite

In this study, we developed the seed-specifically regulated autoexcision system based on Cre/loxP site-specific recombination for coelimination of nptII and cre genes from transgenic plants. To accomplish this, a seed-specific gene promoter, BcNA1, from Brassica napus was used to drive conditional expression of recombinase. NptII and recombinase cassettes were placed between two directly repeated loxP sites. The loxP-flanked DNA was located between the SP-DDEE synthetic pathogen inducible promoter and promoterless β-glucuronidase (Gus) gene, as a model gene of interest. Upon seed-specific expression of cre recombinase, the excision event would eliminate loxP-flanked DNA and bring the gus reporter gene under the control of the inducible promoter. This Cre/loxP system was transformed into Nicotiana tabacum via Agrobacterium-mediated transformation. The regenerated plants were obtained by selection on kanamycin medium and PCR screening. Based on seed germination assay on kanamycin-containing medium, the transgenic lines were subdivided into homogeneous and heterogeneous categories. Phenotypic and molecular analysis of T1 progeny plants indicated that completely NptII-free plants were obtained in homogeneous transgenic lines. Coelimination of NptII and recombinase cassettes were verified with PCR, sequencing, and histochemical Gus staining assay. Full excision efficiency (100%) demonstrates the effectiveness of this autoexcision system for the production of marker gene-free transgenic plants.

show abstract

Construction and functional analysis of pathogen-inducible synthetic promoters in Brassica napus

Cited by 18 publications

References 30 publications

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Synthetic promoters in planta

Efficient seed-specifically regulated autoexcision of marker gene (nptII) with inducible expression of interest gene in transgenic Nicotiana tabacum

Contact Info

Product

Resources

About