Complete Genome Sequence of Pathogenic Guinea Pig Cytomegalovirus from Salivary Gland Homogenates of Infected Animals

Yang, Dongmei; Tamburro, Kristen M.; Dittmer, Dirk P.; Cui, Xiaohong; McVoy, Michael A.; Hernandez-Alvarado, Nelmary; Schleiss, Mark R.

doi:10.1128/genomea.00054-13

Cited by 20 publications

(25 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…6A, upper panel. A parallel study of SG virus (maintained for Ͼ30 years exclusively in vivo through serial passage of SG homogenates in strain 2 guinea pigs [20]) demonstrated similar high levels of stability following serial viral passage in fibroblasts (Fig. 6A, lower panel).…”

Section: Fig 4 Systemic Viral Loads Following Inoculation Of Cyclophomentioning

confidence: 89%

“…Virus derived from N13R10 was highly attenuated in animals compared to virulent SG- passaged virus stocks (11,12). To test for genetic differences that might contribute to attenuation of N13R10 virus, we sequenced the N13R10 BAC (14) and also sequenced the SG-derived GPCMV genome using DNA purified directly from salivary gland homogenates, without any intermediate passage in fibroblasts (20). Remarkably, we found only 13 differences, and of these, only 2 impacted annotated ORFs: a 4-bp deletion/frameshift disrupting GP129 and GP130 and a predicted F81C amino acid substitution in GP130 that is 3= of the 4-bp deletion/frameshift.…”

Section: Discussionmentioning

confidence: 99%

“…PCR using primers GP129-out FW (CTGACCAGCTTGAGAACGTA) and GP129-out RV (ATTAAGCATGGGCGACATCC) was used to generate a 1.2-kb product from DNA extracted from a pathogenic salivary gland stock of GPCMV strain 22122 (20). The product was gel purified, and 200 ng was electroporated into heat-induced electrocompetent E. coli strain SW102 cells containing BAC N13R10-⌬129-galk as described above.…”

Section: Virus and Cells Cell Culture Propagation Of Virus Was Carrimentioning

confidence: 99%

See 2 more Smart Citations

Repair of a Mutation Disrupting the Guinea Pig Cytomegalovirus Pentameric Complex Acquired during Fibroblast Passage Restores Pathogenesis in Immune-Suppressed Guinea Pigs and in the Context of Congenital Infection

McVoy

Wang

Dittmer

et al. 2016

J Virol

Self Cite

View full text Add to dashboard Cite

Guinea pig cytomegalovirus (GPCMV) provides a valuable model for congenital cytomegalovirus transmission. Salivary gland (SG)-passaged stocks of GPCMV are pathogenic, while tissue culture (TC) passage in fibroblasts results in attenuation. Nonpathogenic TC-derived virus N13R10 (cloned as a bacterial artificial chromosome [BAC]) has a 4-bp deletion that disruptsGP129, which encodes a subunit of the GPCMV pentameric complex (PC) believed to govern viral entry into select cell types, and GP130, an overlapping open reading frame (ORF) of unknown function. To determine if this deletion contributes to attenuation of N13R10, markerless gene transfer in Escherichia coli was used to construct virus r129, a variant of N13R10 in which the 4-bp deletion is repaired. Virions from r129 were found to contain GP129 as well as two other PC subunit proteins, GP131 and GP133, whereas these three PC subunits were absent from N13R10 virions. Replication of r129 in fibroblasts appeared unaltered compared to that of N13R10. However, following experimental challenge of immunocompromised guinea pigs, r129 induced significant weight loss, longer duration of viremia, and dramatically higher (up to 1.5 ؋ 10 6 -fold) viral loads in blood and end organs compared to N13R10. In pregnant guinea pigs, challenge with doses of r129 virus of >5 ؋ 10 6 PFU resulted in levels of maternal viremia, congenital transmission, pup viral loads, intrauterine growth restriction, and pup mortality comparable to that induced by pathogenic SG virus, although higher doses of r129 were required. These results suggest that the GP129-GP130 mutation is a significant contributor to attenuation of N13R10, likely by abrogating expression of a functional PC. IMPORTANCETissue culture adaptation of cytomegaloviruses rapidly selects for mutations, deletions, and rearrangements in the genome, particularly for viruses passaged in fibroblast cells. Some of these mutations are focused in the region of the genome encoding components of the pentameric complex (PC), in particular homologs of human cytomegalovirus (HCMV) proteins UL128, UL130, and UL131A. These mutations can attenuate the course of infection when the virus is reintroduced into animals for vaccine and pathogenesis studies. This study demonstrates that a deletion that arose during the process of tissue culture passage can be repaired, with subsequent restoration of pathogenicity, using BAC-based mutagenesis. Restoration of pathogenicity by repair of a frameshift mutation in GPCMV gene GP129 using this approach provides a valuable genetic platform for future studies using the guinea pig model of congenital CMV infection. Infection with human cytomegalovirus (HCMV) is a leading cause of disability in newborns, and development of an effective vaccine is a major public health priority (1, 2). Preclinical modeling of vaccines against congenital infection must rely on the study of species-specific CMVs, since HCMV will not infect nonhuman cells (3, 4). The study of guinea pig cytomegalovirus (GPCMV) is particularl...

show abstract

Section: Fig 4 Systemic Viral Loads Following Inoculation Of Cyclophomentioning

confidence: 89%

Section: Discussionmentioning

confidence: 99%

Section: Virus and Cells Cell Culture Propagation Of Virus Was Carrimentioning

confidence: 99%

See 1 more Smart Citation

Repair of a Mutation Disrupting the Guinea Pig Cytomegalovirus Pentameric Complex Acquired during Fibroblast Passage Restores Pathogenesis in Immune-Suppressed Guinea Pigs and in the Context of Congenital Infection

McVoy

Wang

Dittmer

et al. 2016

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…This approach has had success in the vaccinia virus (VACV) system, where a VACV lacking E3L (48,49) provides a useful comparison. Similar to the PKRinhibitory genes of cytomegaloviruses (26)(27)(28)(29)(30)(31)(32)(33)50), vaccinia virus E3L binds to and sequesters dsRNA and thereby prevents activation of type I interferon-induced PKR and oligoadenylate synthetase (51). In a primate study, an E3L gene deletion was engineered into the New York City Board of Health (NYCBH) strain of vaccinia, and the resulting virus (NYCBH⌬E3L) was examined for No dams in the group immunized with 10 6 PFU had detectable DNAemia at day 21, and the dams were therefore assigned a value of 100 genomes/ml (the threshold of detection of DNAemia by the qPCR assay).…”

Section: Discussionmentioning

confidence: 99%

Vaccination with a Live Attenuated Cytomegalovirus Devoid of a Protein Kinase R Inhibitory Gene Results in Reduced Maternal Viremia and Improved Pregnancy Outcome in a Guinea Pig Congenital Infection Model

Schleiss

Bierle

Swanson

et al. 2015

J Virol

Self Cite

View full text Add to dashboard Cite

Development of a vaccine to prevent congenital cytomegalovirus infection is a major public health priority. Live vaccines attenuated through mutations targeting viral mechanisms responsible for evasion of host defense may be both safe and efficacious. Safety and vaccine efficacy were evaluated using a guinea pig cytomegalovirus (GPCMV) model. Recombinant GPCMV with a targeted deletion of gp145 (designated ⌬145), a viral protein kinase R (PKR) inhibitor, was generated. Attenuation was evaluated following inoculation of 10 7 PFU of ⌬145 or parental virus into guinea pigs immunosuppressed with cyclophosphamide. Efficacy was evaluated by immunizing GPCMV-naive guinea pigs twice with either 10 5 or 10 6 PFU of ⌬145, establishing pregnancy, and challenging the guinea pigs with salivary gland-adapted GPCMV. The immune response, maternal viral load, pup mortality, and congenital infection rates in the vaccine and control groups were compared. ⌬145 was substantially attenuated for replication in immunocompromised guinea pigs. Vaccination with ⌬145 induced enzyme-linked immunosorbent assay (ELISA) and neutralizing antibody levels comparable to those achieved in natural infection. In the higher-and lower-dose vaccine groups, pup mortality was reduced to 1/24 (4%) and 4/29 (14%) pups, respectively, whereas it was 26/31 (81%) in unvaccinated control pups (P < 0.0001 for both groups versus the control group). Congenital infection occurred in 20/31 (65%) control pups but only 8/24 (33%) pups in the group vaccinated with 10 6 PFU (P < 0.05). Significant reductions in the magnitude of maternal DNAemia and pup viral load were noted in the vaccine groups compared to those in the controls. Deletion of a GPCMV genome-encoded PKR inhibitor results in a highly attenuated virus that is immunogenic and protective as a vaccine against transplacental infection. Infection with human cytomegalovirus (HCMV) causes considerable morbidity and occasional mortality in immunocompromised solid organ transplant and hematopoietic stem cell transplant patients, HIV-infected individuals, and newborns that acquire infection in utero (1, 2). Due to the lifelong morbidity associated with congenital CMV infection, a preconception vaccine capable of preventing virus transmission to the fetus would provide a highly cost-effective public health advance (3). Unfortunately, the lack of clear immunological correlates of protective immunity has hampered development of an HCMV vaccine. In spite of this uncertainty, there is evidence that virus-neutralizing antibody responses targeting viral envelope glycoproteins, as well as cellular immune responses (CD4 ϩ and CD8 ϩ ) targeting multiple structural and regulatory proteins, play important roles in protection against acquisition and reactivation of infection (4-7).

show abstract

“…GPCMV PC formation can be demonstrated by transient expression of individual components and the PC has been demonstrated to be a virion component of epithelial tropic GPCMV (67). Serial passage of GPCMV in animals as salivary gland stock maintains selection for the UL128 homolog locus ( GP129-133 ), preserving epithelial cell tropism, pathogenicity, and efficient congenital infection (67, 70). The UL128 homolog locus is unstable when GPCMV is passaged on fibroblast cells, resulting in virus with attenuated tropism and impaired pathogenesis (62, 64, 67).…”

Section: Introductionmentioning

confidence: 99%

Cytomegalovirus UL128 homolog mutants that form a pentameric complex produce virus with impaired epithelial and trophoblast cell tropism and altered pathogenicity in the guinea pig

2017

View full text Add to dashboard Cite

Guinea pig cytomegalovirus (GPCMV) encodes a homolog pentameric complex (PC) for specific cell tropism and congenital infection. In human cytomegalovirus, the PC is an important antibody neutralizing target and GPCMV studies will aid in the development of intervention strategies. Deletion mutants of the C-terminal domains of unique PC proteins (UL128, UL130 and UL131 homologs) were unable to form a PC in separate transient expression assays. Minor modifications to the UL128 homolog (GP129) C-terminal domain enabled PC formation but viruses encoding these mutants had altered tropism to renal and placental trophoblast cells. Mutation of the presumptive CC chemokine motif encoded by GP129 was investigated by alanine substitution of the CC motif (codons 26–27) and cysteines (codons 47 and 62). GP129 chemokine mutants formed PC but GP129 chemokine mutant viruses had reduced epitropism. A GP129 chemokine mutant virus pathogenicity study demonstrated reduced viral load to target organs but highly extended viremia.

show abstract

Complete Genome Sequence of Pathogenic Guinea Pig Cytomegalovirus from Salivary Gland Homogenates of Infected Animals

Cited by 20 publications

References 7 publications

Repair of a Mutation Disrupting the Guinea Pig Cytomegalovirus Pentameric Complex Acquired during Fibroblast Passage Restores Pathogenesis in Immune-Suppressed Guinea Pigs and in the Context of Congenital Infection

Repair of a Mutation Disrupting the Guinea Pig Cytomegalovirus Pentameric Complex Acquired during Fibroblast Passage Restores Pathogenesis in Immune-Suppressed Guinea Pigs and in the Context of Congenital Infection

Vaccination with a Live Attenuated Cytomegalovirus Devoid of a Protein Kinase R Inhibitory Gene Results in Reduced Maternal Viremia and Improved Pregnancy Outcome in a Guinea Pig Congenital Infection Model

Cytomegalovirus UL128 homolog mutants that form a pentameric complex produce virus with impaired epithelial and trophoblast cell tropism and altered pathogenicity in the guinea pig

Contact Info

Product

Resources

About