Vaccination with a Live Attenuated Cytomegalovirus Devoid of a Protein Kinase R Inhibitory Gene Results in Reduced Maternal Viremia and Improved Pregnancy Outcome in a Guinea Pig Congenital Infection Model

Abstract

Development of a vaccine to prevent congenital cytomegalovirus infection is a major public health priority. Live vaccines attenuated through mutations targeting viral mechanisms responsible for evasion of host defense may be both safe and efficacious. Safety and vaccine efficacy were evaluated using a guinea pig cytomegalovirus (GPCMV) model. Recombinant GPCMV with a targeted deletion of gp145 (designated ⌬145), a viral protein kinase R (PKR) inhibitor, was generated. Attenuation was evaluated following inoculation of 10 7 PFU of ⌬145 or parental virus into guinea pigs immunosuppressed with cyclophosphamide. Efficacy was evaluated by immunizing GPCMV-naive guinea pigs twice with either 10 5 or 10 6 PFU of ⌬145, establishing pregnancy, and challenging the guinea pigs with salivary gland-adapted GPCMV. The immune response, maternal viral load, pup mortality, and congenital infection rates in the vaccine and control groups were compared. ⌬145 was substantially attenuated for replication in immunocompromised guinea pigs. Vaccination with ⌬145 induced enzyme-linked immunosorbent assay (ELISA) and neutralizing antibody levels comparable to those achieved in natural infection. In the higher-and lower-dose vaccine groups, pup mortality was reduced to 1/24 (4%) and 4/29 (14%) pups, respectively, whereas it was 26/31 (81%) in unvaccinated control pups (P < 0.0001 for both groups versus the control group). Congenital infection occurred in 20/31 (65%) control pups but only 8/24 (33%) pups in the group vaccinated with 10 6 PFU (P < 0.05). Significant reductions in the magnitude of maternal DNAemia and pup viral load were noted in the vaccine groups compared to those in the controls. Deletion of a GPCMV genome-encoded PKR inhibitor results in a highly attenuated virus that is immunogenic and protective as a vaccine against transplacental infection. Infection with human cytomegalovirus (HCMV) causes considerable morbidity and occasional mortality in immunocompromised solid organ transplant and hematopoietic stem cell transplant patients, HIV-infected individuals, and newborns that acquire infection in utero (1, 2). Due to the lifelong morbidity associated with congenital CMV infection, a preconception vaccine capable of preventing virus transmission to the fetus would provide a highly cost-effective public health advance (3). Unfortunately, the lack of clear immunological correlates of protective immunity has hampered development of an HCMV vaccine. In spite of this uncertainty, there is evidence that virus-neutralizing antibody responses targeting viral envelope glycoproteins, as well as cellular immune responses (CD4 ϩ and CD8 ϩ ) targeting multiple structural and regulatory proteins, play important roles in protection against acquisition and reactivation of infection (4-7).

Repair of a Mutation Disrupting the Guinea Pig Cytomegalovirus Pentameric Complex Acquired during Fibroblast Passage Restores Pathogenesis in Immune-Suppressed Guinea Pigs and in the Context of Congenital Infection

“…Viral loads were determined by qPCR as described previously (8,24). Briefly, DNA was extracted from either 100 l citrated blood (MagNA Pure LC DNA isolation kit I; Roche) or from tissues obtained at necropsy using 0.1 g of homogenized frozen samples of liver, lung, or spleen (MagNA Pure LC DNA isolation kit II; Roche).…”

“…Briefly, DNA was extracted from either 100 l citrated blood (MagNA Pure LC DNA isolation kit I; Roche) or from tissues obtained at necropsy using 0.1 g of homogenized frozen samples of liver, lung, or spleen (MagNA Pure LC DNA isolation kit II; Roche). Amplification primers GP83TM_F1 (CGTCCTCCTGTCGGTCAAAC) and GP83TM_R1 (CTCCGCCTTGAACACCTGAA) were used at a final concentration of 0.4 M, while the GP83 hydrolysis probe (6-carboxyflu orescein [FAM]-CGCCTGCATGACTCACGTCGA-BHQ1) was used at 0.1 M. PCR was performed using the LightCycler 480 real-time PCR system (Roche) under the following conditions: 40°C for 10 s and 95°C for 15 min, followed by 45 amplification cycles of 95°C for 10 s, 56°C for 15 s, and 72°C for 10 s. Data were analyzed with the LightCycler data analysis software (version 1.5; Roche) using standard curves generated from known copy numbers of modified plasmid pCR 2.1 containing GP83 sequences (24). DNAemia was expressed as the total number of genome copies per milliliter of blood.…”

An Evolutionary View of the Arms Race between Protein Kinase R and Large DNA Viruses

“…Guinea pig CMV depleted of its PKR antagonist, gp145, replicates poorly in cell culture, has reduced virulence in animals, and appears to be a safe and potentially effective vaccine for preventing congenital transmission in guinea pigs (15). The fact that it replicates at all suggests that the guinea pig PKR defense system may be less effective than that in humans or mice, or that guinea pig CMV has a second, as yet unidentified, PKR antagonist.…”

Animal models of human cytomegalovirus congenital infection

“…The GPCMV model has been used extensively for evaluating vaccine efficacy, by virtue of the ability to quantify the maternal immune responses, virus loads, as well as developmental sequelae 10 . Several GPCMV vaccines (live attenuated, subunit and DNA) administered before conception, have been evaluated 5,11 . Whilst sterilising immunity to any vaccination program has not been demonstrated, Cost is high for vaccine and drug studies Similar SNHL sequelae 7 Proven model for drug efficacy 6,8,9 Proven model for vaccine immunogenicity and efficacy 5,10,11 Highly refined model with respect to virus dose, timing of infection, end organ disease 9 Mouse MCMV 230 kb Good newborn infection model 12,13 Poor transplacental transmission 6 Excellent knowledge of virus-host interactions 14 Not suited for vaccine/drug efficacy studies targeted at preventing congenital infection…”

“…Under the Microscope the model has informed HCMV vaccination strategies with respect to choice of the immunogen and adjuvant as well as identifying diagnostic correlates of foetal protection, such as the magnitude of the maternal neutralising antibody response to vaccination and reduction in maternal viraemia 5,6,11,23 . The use of vectored approaches for the delivery of subunit GPCMV vaccines that provide both cellular and humoral immunity also significantly reduce the incidence of congenital GPCMV infection 5,24 .…”