Comparison between indirect enzyme-linked immunosorbent assays for Anaplasma marginale antibodies with recombinant major surface protein 5 and initial body antigens

Silva, Virgínia M G; Araújo, Flábio R.; Madruga, C. R.; Soares, Cleber Oliveira; Kessler, Raul H.; Almeida, Maria Ângela Ornelas de; Fragoso, S. P.; Santos, Lenita Ramires dos; Ramos, Carlos A. N.; Bacanelli, Gisele; Torres, Roberto Augusto de Almeida

doi:10.1590/s0074-02762006000500005

Cited by 13 publications

(21 citation statements)

References 22 publications

(13 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…If so, this is not in agreement with Araújo et al (2005), who found a sensitivity of 99% for this test, with sera from naturally-infected cattle, positive for antibodies to A. marginale by IFAT. Silva et al (2006) did not find differences in the performances of ELISAs with crude antigen and with MSP5 as antigens to detect antibodies to A. marginale.…”

Section: Resultsmentioning

confidence: 66%

“…In Brazil, the former agents are transmitted by Rhipicephalus (Boophilus) microplus, while the latter one, besides biological transmission by tick, can also be mechanically transmitted by hematophagous diptera (GUGLIELMONE, 1995). Epidemiological studies showed that, in Brazil, B. bovis, B. bigemina and A. marginale are endemic in several areas (ARA-ÚJO et al, 1998;SMITH et al, 2000;SOARES et al, 2000;SOUZA et al, 2000;MELO et al, 2001;ARAÚJO et al, 2005;BARROS et al, 2005, D'ANDREA et al, 2006. Other factor that may influence the distribution of these pathogens is breed, as B. indicus cattle, because of tick resistance, are less likely to be infected by ticks.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Frequency of antibodies to Babesia bigemina, B. bovis, Anaplasma marginale, Trypanosoma vivax and Borrelia burdgorferi in cattle from the northeastern region of the state of Pará, Brazil

Guedes

Araújo²,

Silva

et al. 2008

Rev. Bras. Parasitol. Vet.

View full text Add to dashboard Cite

Babesiosis, anaplasmosis, and trypanosomosis are relevant diseases, potentially causing morbidity in cattle, leading to economic losses. Borreliosis is import as a potential zoonosis. The objective of this study was to determine, by indirect enzyme-linked immunosorbent assay (ELISA), the frequency of seropositive cattle to Babesia bigemina, B. bovis, Anaplasma marginale, Trypanosoma vivax and Borrelia burgdorferi in cattle from the Northeastern region of Pará, Brazil. Sera samples from 246 female adult cattle from municipalities of Castanhal and São Miguel do Guamá were used. Crude antigens ELISAs were used to detect antibodies to all agents, except to A. marginale, to which an indirect ELISA with recombinant major surface 1a protein (MSP1a) antigen was used. Overall frequencies of seropositive animals were: B. bigemina -99.2%; B. bovis -98.8%; A. marginale -68.3%; T. vivax -93.1% and B. burgdorferi -54.9%. The frequencies of seropositive cattle to B. bovis and B. bigemina suggest a high rate of transmission of these organisms by tick in the studied region, which can be classified as enzootically stable to these hemoprotozoans. The low frequency of seropositive cattle to A. marginale may be attributed to a lower sensitivity of the recombinant antigen ELISA utilized or a distinct rate of inoculation of this rickettsia by ticks, as compared with Babesia sp. transmission. The high frequency of seropositive cattle to T. vivax indicates that this hemoprotozoan is prevalent in herds from the Northeastern region of Pará. The rate of animal that showed homologues antibodies to B. burgdorferi indicates the presence of the tickborne spirochaetal agent in the cattle population in the studied region.

show abstract

Section: Resultsmentioning

confidence: 66%

Section: Introductionmentioning

confidence: 99%

Frequency of antibodies to Babesia bigemina, B. bovis, Anaplasma marginale, Trypanosoma vivax and Borrelia burdgorferi in cattle from the northeastern region of the state of Pará, Brazil

Guedes

Araújo²,

Silva

et al. 2008

Rev. Bras. Parasitol. Vet.

View full text Add to dashboard Cite

show abstract

“…The end point PCR was performed using the primers msp5F 5' ATGAGAATTTTCAAGATTGTGTCTAACCTT 3' and msp5R 5' AGGAAAGCCCCCAAAGCCCCATACTT 3', which delimit all msp5 genes of A. marginale, and a 3' untranslated region, according to Silva et al (2006), resulting in an amplicon of 714 bp. Amplification conditions were: 94°C for 4 minutes, followed by 35 cycles at 94°C for 1 minute, 60°C for 30 seconds and 72°C for 45 seconds.…”

Section: Methodsmentioning

confidence: 99%

Molecular diagnosis of Anaplasma marginale in cattle: quantitative evaluation of a real-time PCR (Polymerase Chain Reaction) based on msp5 gene

Bacanelli

Ramos

Araújo³

2014

Pesq. Vet. Bras.

View full text Add to dashboard Cite

Pesq. Vet. Bras. 34(1):29-33, janeiro 2014 29 RESUMO.-[Diagnóstico molecular de Anaplasma marginale em bovinos: avaliação quantitativa de uma PCR em tempo real baseada no gene msp5.] A riquétsia Anaplasma marginale é considerada o principal agente da anaplasmose bovina. Devido a não especificidade dos sinais clínicos, a confirmação da infecção nos animais depende de testes laboratoriais. Recentemente, métodos de diagnóstico molecular têm sido aplicados para detecção de A. marginale em bovinos. No entanto, a grande quantidade de testes com diferentes sensibilidade e custos tem dificultado a escolha do ensaio mais adequado. No presente estudo, uma PCR em tempo real baseada no gene msp5 foi avaliada quantitativamente e comparada a uma reação de PCR convencional. As reações foram submetidas à avaliação de sensibilidade e especificidade com DNA plasmidial e amostras provenientes de bovinos experimentalmente infectados por A. marginale. Uma avaliação comparativa a campo foi realizada entre os testes utilizando amostras provenientes de bovinos criados em uma região de estabilidade enzoótica para A. marginale. Embora os testes não tenham apresentado diferença estatisticamente significativa, a PCR em tempo real apresentou valor de sensibilidade maior do que a PCR convencional. A PCR em tempo real foi capaz de detectar uma cópia de msp5 em 100ng de DNA plasmidial, e mais de 80% de resultados positivos entre bovinos experimentalmente infectados apenas sete dias após infecção. Além disso, baseado em análise in silico, a PCR em tempo real avaliada aqui pode ser útil para detecção de Anaplasma ovis. The rickettsia Anaplasma marginale is considered the main agent of bovine anaplasmosis. Due the nonspecific clinical signs of the anaplasmosis, the diagnosis of infection depends of laboratory confirmation. In recent years, molecular diagnostic methods have been used to detect A. marginale in cattle. However, the existence of a large number of assays of different sensitivity and cost makes the choice of an appropriate test difficult. In the present study, a real-time Polymerase Chain Reaction (PCR) based on the msp5 target gene was quantitatively assessed and compared to an end point PCR. Both reactions were subjected to sensitivity and specificity evaluation using plasmid DNA and samples from cattle experimentally infected with A. marginale. A comparative field trial of the tests was carried out using samples of cattle from a stable enzootic area for A. marginale. The real-time PCR showed a higher sensitivity than the end point PCR. This reaction (i.e. real-time PCR) was able to detect one copy of the msp5 gene in 100 ηg of plasmidial DNA, and more than 80% of its results were positive among experimentally infected animals seven days after infection. In addition, based on in silico analysis, the real-time PCR evaluated in the present study appears to be useful for the detection of A. ovis.

show abstract

“…Serum samples were from 72 Aberdeen-Angus cattle experimentally infected with Rio Grande do Norte homologous isolate of A. marginale; from 72 Anaplasmafree cattle, defined by PCR for MSP5 gene (Silva et al 2006); from 70 cattle naturally infected with this rickettsia from state of Alagoas, positive by indirect ELISA with MSP5 (Melo et al 2007); and from 72 seronegative cattle, all of which were analyzed by ELISAs with VirB9, VirB10, and EF-Tu for specific IgG.…”

Section: Amplification Of Virb9 Virb10 and Ef-tu -Primersmentioning

confidence: 99%

IgG and IgG2 antibodies from cattle naturally infected with Anaplasma marginale recognize the recombinant vaccine candidate antigens VirB9, VirB10, and elongation factor-Tu

Araújo

Costa

Ramos

et al. 2008

Mem. Inst. Oswaldo Cruz

Self Cite

View full text Add to dashboard Cite

show abstract

Comparison between indirect enzyme-linked immunosorbent assays for Anaplasma marginale antibodies with recombinant major surface protein 5 and initial body antigens

Abstract: Indirect enzyme-linked immunosorbent assays (ELISAs) based on recombinant major surface protein 5 (rMSP5) and initial body (IB) antigens from a Brazilian isolate of

Cited by 13 publications

References 22 publications

Frequency of antibodies to Babesia bigemina, B. bovis, Anaplasma marginale, Trypanosoma vivax and Borrelia burdgorferi in cattle from the northeastern region of the state of Pará, Brazil

Frequency of antibodies to Babesia bigemina, B. bovis, Anaplasma marginale, Trypanosoma vivax and Borrelia burdgorferi in cattle from the northeastern region of the state of Pará, Brazil

Molecular diagnosis of Anaplasma marginale in cattle: quantitative evaluation of a real-time PCR (Polymerase Chain Reaction) based on msp5 gene

IgG and IgG2 antibodies from cattle naturally infected with Anaplasma marginale recognize the recombinant vaccine candidate antigens VirB9, VirB10, and elongation factor-Tu

Contact Info

Product

Resources

About